Why it isn't evolution - proof against Darwin

[HideoHo]

Many people on the board continually argue that there is no proof for Creationism while there is plenty of proof for Evolution. While there isn't any way to prove Creationism, evolution certainly has very little proof for it and a good deal of proof against it.

First, get this book: Darwin's Black Box: The Biochemical Challenge to Evolution - Michael J. Behe

This book has a lot of put Biochemistry, but it's also explained in more laymen's terms.

The main point of the book isn't that natural selection doesn't occur but that interspecies change doesn't occur.

Most people use the England moths as an example of evolution, with their changing colors due to pollution. Which moth is more evolved, however? The white ones before the pollution, black ones during pollution, or the white ones after the air has been cleaned again? None of these are evolutionary changes, just physical changes that were naturally occuring already. When the black moths blended better, they had more of a chance to multiply. The same thing happened later with the white moths.

You could put this idea to people, also, as there are dark and light humans. Who is more evolved here? I say neither, as both black and white people have the ability to have opposite colored children, and they also have the ability to mate with eachother.

Onto another common evolutionary argument: it's easy to see how a light sensitive cell turns into an eye. Think about each step of this process;

More and more photosensitive cells are placed in a much more tightly packed matrix. As each generation of animal is born, there are more cells in the matrix and a finer resolution. You can equate this to LCD screens, even, as calculators have big cells, but your kid's Gameboy has a bunch of little cells.

At what point does the 'LCD' turn into a cathode ray tube, however?

There are several parts to the human eye that are required for it to work properly: the lens, the cornea, the focusing, the ability to open and close the iris - this ignores the fact that your brain is able to not only flip the image, but compute what you're actually seeing.

Without any of these, the eye does not work. What mutation will cause a bunch of cells stacked together to simultaneously grow a lens, pupil, optical nerve and everything else needed for a simple eye?

This argument ignores the fact that there is NO similarity chemically to the two reactions of photosensitive cells and eyes.

I'm not arguing that Creationism is what happened but I am arguing against the Darwin theory that a few million years ago we were all rats (or monkeys, or clams depending on religion) scurrying around after all the dinosaurs all died.

I would suggest that anyone who says that evolution as been proven read the above listed book.

John

[Nen]

Natural selection as asserted by Darwin is a theory, i.e. it cannot be proved; however, much evidence exists which supports the hypothesis. How does your argument constitute proof against the possibility of Darwinian evolution?

[HideoHo]

The proof is that that in Biochemistry, there IS no relation between these things that Darwin could easily see happened (photosensitive cells to eyes, single celled organisms to humans). The actual chemistry of it is complex, but I will dictate it when I grab the book from home if it will help.

The author puts in a good analogy: Say you have a 20,000 lane highway with heavy traffic zipping along at 100mph. Suppose a tortis is at one end and crosses the road. Theoretically, the tortis will make it...

[Ike Witt]

Originally posted by HideoHo

The author puts in a good analogy: Say you have a 20,000 lane highway with heavy traffic zipping along at 100mph. Suppose a tortis is at one end and crosses the road. Theoretically, the tortis will make it...

What the hell does this have to do with anything?

[Unauthorized Cinnamon]

Wow, HideoHo, I've never heard those arguments before. I'm sure that proponents of the theory of natural selection have no adequate answers, just as I'm sure the author of this book is non-religious and unbiased. Thanks for pointing out that evolution uses a scale reflecting what living things are "more" or "less" evolved - I had no idea! You've completely convinced me that the "fact" of evolution is really a farce! :rolleyes:

[Nen]

I fail to see how the concepts of natural selection, genetic drift, mutation and gene flow are incongruous with the nature of biochemistry. Perhaps you can provide some specific examples (not analogies) or a detailed theory pertaining to precisely how biochemistry dictates evolution is impossible.

[Mr.Zambezi]

well, I am 6,000 years old and was there at the beginning of the world. Every creature was already there and I personally installed all of the dinosaur fossils.

While I am here, I would like to point out the so calle scientific method is crap. Obsevation based on a very small "n" is the only reliable source of truth.

Oh, and I am sending you all to hell.

[HideoHo]

As a matter of fact, this book is non-religious. Sorry to burst your bubble.

The problem with evolution as going from monkeys to men is what I'm arguing, not changing colors, or getting bigger or smaller. People have known how to breed horses to get exactly what they wanted, but is this isn't evolution, it's just changing the percentages of certain traits. There are tall people in the world. If all the short people stop reproducing, but the tall people continue to reproduce, there will be a whole lot more tall people. This isn't evolution, it's selective breeding.

The idea of life being simple is what's wrong with the theory of evolution. 138 Chain Protiens can change their chemical makup with just a slight change of their matrix. It can go from being a protein for your eye to a protein for your gall bladder without ever changing what it's made up of. This is why evolution, or what people call Macroevolution isn't feasable. It's not flipping one or two random switches then breeding those animals with the superior gene. It's flipping 20,000 switches that are all carefully placed in making what evolutionists call a simple step.

The reason that you don't have an argument against the biochemistry of it is because Darwin didn't KNOW about this part. It was Darwin's black box (get it?). I would like to hear some new arguments for evolution based on the new knowledge of cells and protiens that we have now, though.

[Emustrangler]

Please please please someone explain that tortise analogy to me. I'm very confused

[QuickSilver]

From Amazon.com's Editorial Review, first sentence:


Darwin's Black Box : The Biochemical Challenge to Evolution

- Michael J. Behe, a biochemist at Lehigh University, presents here a scientific argument for the existence of God.



'nuff said?

[HideoHo]

Having read the book, I do know that it's not religous, but scientific in nature. As it appears, I've come to an argument that's met with rebuttles that I'm just a religious nut and therefore have no say.

Fine with me, and I will post the actual quotes from the text later if anyone would like to see - why evolution isn't possible from a Biochemical stance. Biochemistry is Science, taught in college and everything (hey, maybe THIS'll give it some substance), for those people who say that this is just a religious arument. I was just hoping to see a view point that wasn't just blowing me off.

Oh well.

[lissener]

Originally posted by HideoHo
. . . evolution certainly has very little proof for it and a good deal of proof against it. . . .This simply displays your ignorance of the issue.

continued
. . . First, get this book: Darwin's Black Box: The Biochemical Challenge to Evolution - Michael J. Behe

From a review quoted at amazon.com: “Behe (biochemistry, Lehigh U.) looks at evidence in biochemistry pointing toward the limits of evolutionary theory, arguing that the complexity and interdependence of biochemical systems make it harder to envision Darwin's gradual changes. He asserts that biochemical machines must have been designed by some type of higher intelligence. Includes an appendix explaining basic concepts in the chemistry of life.” (emphasis mine)

This is compelling evidence? The old “argument from design” red herring is just an expression of inability to understand, and an illogical leap based on that inability. It is in no way a scientific approach to the issue. Being unable to visualize the link-to-link progression of the development of the eye is not a statement about evolution; it’s a statement about the capacity of the human mind to understand extremely complex processes.

continued
. . . The main point of the book isn't that natural selection doesn't occur but that interspecies change doesn't occur. . . .From another review: “Examining the evolutionary theory of the origins of life, can go part of the way with Darwin--he accepts the idea that species have been differentiated by the mechanism of natural selection from a common ancestor. ”

Apparently, HideHo, you need to read the book.

continued
[B]. . . Which moth is more evolved, however? . . . dark and light humans. Who is more evolved here? . . .This is a fallacy: evolution is not about “more evolved” or “less evolved”; the ladder imager commonly associated with it is not accurate. Evolution tends toward greater diversity, not toward some abstract goal of “better” (Keep in mind that some organisms don’t adapt quickly enough and may die out). So your objection is irrelevant.

How do these examples of the continuing nature of evolution and the fluid boundaries between the groups of animals arbitrarily dubbed "species" or "races" for the linguistic convenience of scientists in any way contradict Darwin?
continued
. . . I would suggest that anyone who says that evolution as been proven [i.e., the entire scientific community :rolleyes: ] read the above listed book.I would suggest that anyone who is swayed by this book’s thesis that evolution is just too complex a process to understand should read a few other books.

[andros]

but it's too good to pass up.

HideoHo, how do you explain protein homology from a creationist standpoint?

[Nen]

Originally posted by HideoHo
If all the short people stop reproducing, but the tall people continue to reproduce, there will be a whole lot more tall people. This isn't evolution, it's selective breeding.

It is selective breeding. It is also known as artificial selection. Regardless, it will yield a change in gene frequency. Over a period of several generations a tall phenotype will emerge. By definition, it is evolution.

Originally posted by HideoHo
The idea of life being simple...[snip, imagine the paragraph in its entirety]...evolutionists call a simple step.

Where is the proof in that paragraph? The allegations that anthropologists deem the steps in evolution to be simple is preposterous. I doubt you have an understanding of the nature of evolution. Evolution happens to a population, not an individual. The "switch flipping" you describe, if I understand the aim of the analogy, occurs over great periods of time among a population. Essentially, your argument is void of relevant content.

Originally posted by HideoHo
The reason that you don't have an argument against the biochemistry of it is because Darwin didn't KNOW about this part.

Oh, I see. We can't provide arguments because someone else lacked exposure to a specific realm of knowledge. You've made that very clear.

[pldennison]

First of all, while the book itself may be fairly religiously neutral, Behe himself is not, and aligns himself with such Creationist apologists as Philip Johnson.

Second of all, Behe's primary argument involves "irreduceable complexity," often in completely inapplicable ways. (As in, "We haven't yet found a biochemical explanation for X, therefore there isn't one.")

Third, Behe's arguments are addressed by several evolutionary biologists, most notably by Brown University biologist (and devout Christian) Kenneth Miller in his book Finding Darwin's God (http://www.amazon.com/exec/obidos/ASIN/0060175931/o/qid=969644396/sr=8-1/ref=aps_sr_b_1_3/103-1838199-7405448). He pretty much puts to rest Behe's objections on the grounds of irreducible complexity.

Fourth, the eye argument is clearly and concisely addressed by Richard Dawkins in Climbing Mt. Improbable (http://www.amazon.com/exec/obidos/ASIN/0393316823/qid=969644574/sr=1-1/103-1838199-7405448)

Fifth, the phrase "more evolved" is a non sequitur, containing no semantic content whatsoever in a discussion of Darwin or natural selection.

[DRS]

Originally posted by HideoHo

There are several parts to the human eye that are required for it to work properly: the lens, the cornea, the focusing, the ability to open and close the iris - this ignores the fact that your brain is able to not only flip the image, but compute what you're actually seeing.


The most frustrating thing about debating evolution is that even the most spurious arguments have to be refuted again and again. PLEASE take a look and then a second one at http://www.talkorigins.org/

On this particular issue of the eye: yes, it has lots of parts. It's simply not true that all those separate developments would have had to come together at once for an organism to have an eye that would provide some survival advantage.

To take the simplest example, think of cataract surgery. The ancient Babylonians were removing cloudly lenses from eyes long before there were glasses or lens implants. What would the point of that have been if an eye without a lens is useless? It certainly suggests that an eye without a lens is a heck of a lot better than no eye at all.

[HalberMensch242]

HideoHo said "I would like to hear some new arguments for evolution based on the new knowledge of cells and protiens that we have now, though."

Well..maybe if you read any of the recent sciece journals or literature...you would find that evolution is being explained..using genetic information, biochemical make up and cell structure. Even taxanomy has been traced back using genetic make up of organisms..general or mere physical obervations of species are.and haven't been the norm for a long long time.
Here is a great example of evolution theory..worked into a feasable hypothesis.
The evolution of early prokaryotes, who had no mitchondria or chloroplast, into the modern form of cell structure. This proto-eukaryote absorbed or formed a symbiotic relationship with a prokaryote(mitochondria or chloroplast), and thorugh several generation these organisms become one.

[Unauthorized Cinnamon]

I said:I'm sure the author of this book is non-religious and unbiased.

HideoHo responded:As a matter of fact, this book is non-religious. Sorry to burst your bubble.

Sorry to burst your bubble, but you are responding to a statement I didn't make. My point is that the author is religious (he is Catholic, and a proponent of Intelligent Design theory), and therefore biased. He need not make his bias obvious in this "scientific" book for it to influence his research and theory. For someone arguing about what a book says, you seem to have remarkably low reading comprehension.

Here's a critical review of Darwin's Black Box: http://www-polisci.mit.edu/bostonreview/br21.6/orr.html

Here's an explanation of the evolution of irreducibly complex systems: http://www.cs.colorado.edu/~lindsay/creation/evolve_irreducible.html

And here's a page compiling many arguments pro and con Behe's theories: http://www.infidels.org/library/modern/science/creationism/behe.html

[QuickSilver]

Originally posted by HideoHo
As it appears, I've come to an argument that's met with rebuttles that I'm just a religious nut and therefore have no say.


Now is that really what we said?

I just think that some of us are naturally suspicious of the author's premise and scientific methodes.

[Robot Arm]

This goes slightly to your point about eyes, and how some parts of our bodies require sophisticated structures to work the way they do.

I saw a documentary once about biologists who were studying flies. They wanted to know how non-winged insects could evolve into winged insects, since evolution is supposed to operate by small, incremental changes and wings have to be fairly large to be useful. IIRC, they took some flies of some sort and clipped their wings (simulating a step in their evolution), then watched how they behaved. It turned out that even though they couldn't fly, they used their wings to propel themselves around on the surface of a pond. Presumably, this helped them avoid predators. And since bigger wings could move faster than smaller wings, that trait was selected for until the wings were large enough to leave the ground entirely.

Our eyes are marvelously sophisticated, no question. But does that book leave no possibility that they developed through subtle stages, each a tiny improvement over the last? And even if we don't know all the details of that process, that doesn't disprove evolution.

[friedo]

Originally posted by HideoHo
The problem with evolution as going from monkeys to men is what I'm arguing, not changing colors, or getting bigger or smaller. People have known how to breed horses to get exactly what they wanted, but is this isn't evolution, it's just changing the percentages of certain traits. There are tall people in the world. If all the short people stop reproducing, but the tall people continue to reproduce, there will be a whole lot more tall people. This isn't evolution, it's selective breeding.


Stir in Natural Selection, yields one Theory of Evolution.

You've just described exactly how evolution works. Evolution is, as you put it, "selective breeding" with the selection occuring in nature.

[lissener]

HideHo--

Despite the general tone of the responses to your OP, I for one do get the impression that you are sincerely seeking an axchange on this matter. If that is the case, I'll read Behe's book, to try to gain a better understanding of your viewpoint, if you are willing to add to your knowledge base. Your statement that there is insufficient evidence to support evolution is simply, and emphatically, incorrect. Read a couple of the following titles, and then I'd sincerely be interested in your response.

The Beak of the Finch by Jonathan Weiner

River Out of Eden by Richard Dawkins

Originally posted by pldennison
. . . the eye argument is clearly and concisely addressed by Richard Dawkins in Climbing Mt. Improbable (http://www.amazon.com/exec/obidos/ASIN/0393316823/qid=969644574/sr=1-1/103-1838199-7405448) . . .

[Philster]

I'm gonna play stupid here.

We have fossil records of "man" in progressive stages of development. We have cro-magnum, neanderthal, etc. Okay, granted, there are some "missing links", as it would be very difficult to create one harmonious set of steps in the very short period of time that serious investigation into fossil records has been done. What am I missing?

The burden of proof is not not necessary. Based on the evidence, what can we reasonably conclude?

I understand that the crux of the arguement is that interspecies change doesn't occur. That must be the crux, so let's stick to that point. Obviously, arguing that natural selection doesn't exist would be foolish. The influenza virus prooves this every year, as it mutates to survive the previous years' influenza vaccine created antibodies.

So, let's say it's the interspecies thing we are stuck on.

What would be looking for as "proof" of, or at least evidence of, interspecies evolution? What seperates species? If different creatures mate and their offspring can reproduce, bingo, new species. How do you "see" that transition in fossil records? How does it appear as evidence? We are down to the cellular level now. Digging up fossils is easy. We see extinction, and we see new species starting at different times. Getting at the matter as an issue of subtle changes that determine whether fertile offspring can be reproduced ain't gonna be easy!

So many creatures are sooo closely related (aka Chimps and Humans). It is my understadning that no other animals are more closely related genetically than chimps and humans. Genetically speaking, the difference is frightingly small. We either have a very similar lineage with subtle changes over millions of years, or a creator put very little effort into separating the design of the two species. Less effort than went into seperating any other two species! Heck! If there is creator, he took some old blue prints and touched them up a teeny bit...and BAM...humans.

Transitions are terribly subtle, not sudden.

[HideoHo]

Well, I am glad to have real arguments against it. Thanks, DRS and pldennison.

Also, I've said from the beginning that this isn't a creationist argument, just an argument against Darwin.

The book mentioned by pldennison from a quote on the Amazon.com Review "Rather, he argues that in a truly open-minded assessment of Darwin's evolution, there emerges a living manifestation of the divine wisdom that made possible a universe of living creatures acting on unscripted impulses. "

For the sake of clarity, I've lurked for a long time, nothing will get people to read a thread like a line such as 'who's more evolved, the black or white humans?'.

Now, the main argument against Darwin isn't that creatures change, as they do. Humans have less hair, more brains than we used to (so is assumed). But I have two problems with the Darwin theory, one which is the interspecies change (from say, ameoba to human). It's not to say I think of myself too highly that I can't come from an ameoba, as I resemble them greatly. It's the fact that the sheer amount of changes needed are amazing, and that some changes are very infeasable from a chemical standpoint. The fact that many of the systems are interdependent make the possibilities of these changes happenening extremely slim (I've seen numbers as low as 1/10^46,000 on this, but I don't have the source, so I won't say that THIS is the number).

The other idea is that we are just a big accident from lightning hitting the sea or what have you. The possibility of this is even lower, as all of these chemicals and protiens happening to come together in the one exact configuration that would work is so low as to be statistically impossible.

What I am looking for is proof that 'Yes, here is the missing link (any two separate species will do)' or someone to setup a lightning machine in some distilled water and make life.

[Harris]

HideoHo, how do you explain protein homology from a creationist standpoint?


Screw that, what the hell was all that stuff with the Tortoise about?

[HideoHo]

Sorry, replys coming in faster than I can respond. Suffice to say, I'll look into the books that I can, as I am curious about it.

Btw: tortis - sure, theoretically, a tortis can make it across the road. It's chances are damn slim. IE, chances of evolution are damn slim (the author assumes you got the point and doesn't spell it out like that in the book).

Anyways, the argument with the eyes was not only that a lense was needed, but that such a great chemical change was needed that it's like saying that photosensitive cells were changing into livers. We've driven pldennison and lissener insane still using this, so I'll refrain from this futher till I read the website listed.

A large part of evolution is at what point can a single species no longer mate with itself and become another species? There was the idea of two different species making a third. Are humans the offspring of Chimps and Dolphins? If we came from monkeys, why aren't we backwards compatable? Who was the first person that couldn't have sex with his peers? If it was a whole area that had it's apes evolving into humans, why did there still seem to be chimps in the same areas as the first humans at the same time?

Also, glad to see a few people arguing in a serious matter, and the fact that no one here is a Biochemist, or God (right?) so we're going on what we believe and others tell us, not our own experience, so you can't make me take insults personally so nyaaaa :-P

I have some reading to do, so I'll try to pick those up and check out the websites. I suggest you do the same.

[andros]

The other idea is that we are just a big accident from lightning hitting the sea or what have you. The possibility of this is even lower, as all of these chemicals and protiens happening to come together in the one exact configuration that would work is so low as to be statistically impossible.

You're describing what is known as abiogenesis here (lit. "life from nothing"). And Chuck Darwin never ever discussed the ultimate origin of life on Earth. Evolution doesn't generally deal with how live came about, it deals with how life behaves and changes.

You will never get a "missing link." There is no one species that separates you from an amoeba. In fact, the term "missing link" is a falsehood in and of itself, used now by Creationists who refuse to understand that evolution is a process rather than a means to an end.

[lissener]

Originally posted by HideoHo
. . .I have two problems with the Darwin theory, one which is the interspecies change (from say, ameoba to human). To continue to insist on emphasizing the A to Z leap rather than the A to B to C to D . . . process strikes me more and more as just plain dishonest. You're willfully reframing it so as it make it more difficult to understand, rather than looking at it in such a way that you can understand it.

This is like saying your brain can't encompass the leap from stone wheel to space shuttle. Well, then don't skip so many freakin' steps if you're honestly trying to understand the process!
continued
. . . The fact that many of the systems are interdependent make the possibilities of these changes happenening extremely slim. . . And this is like telling a lotto that there's no way he could've won. He did, we did evolve. Now use that as a tool to understand the math, rather than using your inability to understand the math as an excuse to deny the existence of the lotto winner looking at you from the mirror.
continued
. . . The other idea is that we are just a big accident from lightning hitting the sea or what have you. . . .I would think this image would sit pretty well with the denialists: the Hand of God and all that.
continued
. . . What I am looking for is proof that 'Yes, here is the missing link (any two separate species will do)' . . .
The Myth of the Missing Link has been covered and covered and covered and covered. Read this thread (http://boards.straightdope.com/sdmb/showthread.php?threadid=39246) before you trot out this tired old red herring.
continued
. . . or someone to setup a lightning machine in some distilled water and make life. So, you won't believe the fact of evolution until other branches of science have developed the technological advances that will allow them to create life? Great argument. :rolleyes:

[Ptahlis]

What the...? It's been an hour and a half and David B. still hasn't shown up to fight his favorite fight against ignorance? Must be on a long lunch.

To address two points I see in preview:

There is no such thing as a "missing link." You will never find one because every single thing is one. This is a red herring thrown out by evolution deniers. What qualities exactly are you looking for in such an animal anyway? What do you think a so-called missing link between humans and non-human primates would be like?

Also, biogenesis and evolution are separate, albeit related, theories. And as far as the number of changes being too large, might I remind you how many billions of years this took? There are over six billion humans on this planet, and we are just one species. If you look at how many billions of years the planet has been around, how many species there are and were (not that we have any kind of accurate account of this), and how many individuals comprised the populations of all these species, then you might have cause to rethink how unlikely it is that these changes could have occurred.

[lissener]

Originally posted by HideoHo
. . . If it was a whole area that had it's apes evolving into humans, why did there still seem to be chimps in the same areas as the first humans at the same time? . . .Again, this statement is about your lack of understanding; it's not the weak link in evolution you think it is.

Species don't evolve from each other in sequence; they don't just replace one another. Evolution is like a branching bush, not a ladder: the common ancestor of chimps and humans, by parenting those two branches, is under no obligation to leave the stage. If they die out it's because they are no longer the best suited to compete for their niche, not because they have evolutionary offspring.

[Freyr]

HideoHo wrote:

The other idea is that we are just a big accident from lightning hitting the sea or what have you. The possibility of this is even lower, as all of these chemicals and protiens happening to come together in the one exact
configuration that would work is so low as to be statistically impossible.

What I am looking for is proof that 'Yes, here is the missing link (any two separate species will do)' or someone
to setup a lightning machine in some distilled water and make life.

An important point I think you're missing HideoHo is that individuals DO NOT evolve. Species DO evolve, populations DO evolve. You say that for a particular mutation or chemical step to occur, the odds are very low for something like that to occur. Very true. But if I have 1 thousand or 1 million members of a species doing it, suddenly the chance of occurance becomes very probable.

Here's a real world example. Take 4 6-sided die. What are the odds of you (by yourself) getting all of the 6s to show up on one throw? Pretty high, eh? Now take 100 people and give them all 4 6-sided die and let them toss them at the same time. You see my point?

It's the same thing with the chemicals coming together to form the first living cell. At any particular instance, at any particular time, the odds are pretty low. Now consider a whole OCEAN full of those chemicals over a period of say 1 million years. The odds suddenly become favorable for it.

As for seeing a species in transition, I don't have the site, but there's a famous fossil that shows the body of a lizard with bird wings. Anyone know where a pic of that can be found on the web?

[QuickSilver]

I think the aspect which , for one reason or another, you continue to misunderstand is simply this. It's not that chances of life evolving from this prehistoric chemical soup are extremely small and infeazable (as you like to speculate). It's that the lack of our current understanding of this ecology which spans millions of years in time does not immediately compell us to assume that supernatural forces are at play. Just because one does not understand something does not mean it is is un-knowable or devine. It just means we have not unlocked it's sectrets yet. Give it time HedeoHo, give it time. Life did not evolve in one day (or six for that matter). It will take humanity some time to answer many of these questions.

[mountain man]

Originally posted by Ptahlis
This is a red herring thrown out by evolution deniers.

Originally posted by lissener
The Myth of the Missing Link has been covered and covered and covered and covered. Read this thread before you trot out this tired old red herring.


So the missing link is a red herring? Personally, I can't imagine the jump from amoeba to red herring let alone red herring to human.

[Opus1]

HideoHo, I sense that you are seriously interested, but just ignorant and miinformed about evolution. Here are some of your misstatements and misunderstandings, which explain why it is that you probably don't accept evolution.

First of all, I highly doubt that you have read Behe's book. If you had, you would have known that Behe accepts common descent through natural selection. He simply believes that some structures are so irreducably complex as to require a designer. While Behe has greatly muddled the issue by voluntarily cozying up with creationists, he does indeed accept evolution.

Secondly, there is no such thing as more or less evolved. We are all equally evolved.

Thirdly, you say that breeding horses is not real evolution, just a change in percentage of traits. That's exactly how biologists define evoultion! The exact definition is "a change in allelle frequency over time," i.e., change in the percentage of traits! It may not be speciation, but it is evolution.

But I have two problems with the Darwin theory, one which is the interspecies change (from say, ameoba to human). It's not to say I think of myself too highly that I can't come from an ameoba, as I resemble them greatly. It's the fact that the sheer amount of changes needed are amazing, and that some changes are very infeasable from a chemical standpoint. The fact that many of the systems are interdependent make the possibilities of these changes happenening extremely slim (I've seen numbers as low as 1/10^46,000 on this, but I don't have the source, so I won't say that THIS is the number).

The other idea is that we are just a big accident from lightning hitting the sea or what have you. The possibility of this is even lower, as all of these chemicals and protiens happening to come together in the one exact configuration that would work is so low as to be statistically impossible.


Okay, this is another problem. You truly fail to understand what evolution says. Humans did not evolve from amoebas. We share a common ancestor with them. The number of changes needed for evolution to occur is actually quite small. I believe that 100 darwins is the rate of mutation necessary to turn a mouse into an elephant in 10,000 years. Mutation rates of up to 80,000 thousand have been observed in the laboratory. So this is certainly not a problem for evolution.

Your numbers on abiogenesis are also b.s. We don't know how abiogensis occurred, so we can't peg odds onto it. See http://www.infidels.org/library/modern/richard_carrier/addendaB.html for how these calculations are done, and why they are specious.

A large part of evolution is at what point can a single species no longer mate with itself and become another species? There was the idea of two different species making a third. Are humans the offspring of Chimps and Dolphins? If we came from monkeys, why aren't we backwards compatable? Who was the first person that couldn't have sex with his peers? If it was a whole area that had it's apes evolving into humans, why did there still seem to be chimps in the same areas as the first humans at the same time?

This is such a misunderstanding of evolution I don't even know where to begin to correct it. Speciation has been observed to occur in nature and in the laboratory, so arguing against it is rather futile. I've never heard of the idea that two species mate to make a third, except for hybrids like mules which are ususally sterile. Humans are not the offspring of chimps and dolphins. If that's what your perception of evolution is, no wonder you don't accept it. There was no first person who couldn't have sex with his peers, because speciation is ususally a group, rather than individual thing. Think of language changes over time. Old English is practically unrecognizable and incomprehensible to us Modern English speakers. So, who was the first person who spoke so differently that he couldn't communicate with his peers? Do you realize the absurdity of this question now?

I don't understand your last question so I can't answer it. It sounds like it has something to do with sympatric and allopatric speciation, but I'm not sure, so I'll let you restate it more clearly.

Anyway, the point of all of this is to clear off your misconceptions, and learn what evolutionary theory really teaches before you reject it.

[lissener]

Originally posted by Opus1
. . . There was no first person who couldn't have sex with his peers, because speciation is ususally a group, rather than individual thing. Think of language changes over time. Old English is practically unrecognizable and incomprehensible to us Modern English speakers. So, who was the first person who spoke so differently that he couldn't communicate with his peers? . . .I'ma plagiarize that one. Very nice.

[HideoHo]

Unfortunatly, I have work to do, so this is the last post today.

The chances of the spontanious life occurance was calculated as 1/ largest number ever (number of times every hydrogen electron has gone around it's nucleous since the beginning of time) and while this is still a chance, not a statistically possible one. Again, being at work, I don't have which book this is from, though I can get that for you.

Another point of contention, I'm thinking in too large of a step. At what point does a single cell organism go to two or more cells? We've been working with bacteria for years, growing it and had millions of generations yet we've not seen advances in these bacterias other than having immunities to certain antibiotics. Why?

Anyways, I'll see you later, try not to flame to so hard that I gotta look this thread up in the pit later.

[Phobos]

Originally posted by Opus1

If it was a whole area that had it's apes evolving into humans, why did there still seem to be chimps in the same areas as the first humans at the same time?

I don't understand your last question so I can't answer it. It sounds like it has something to do with sympatric and allopatric speciation, but I'm not sure, so I'll let you restate it more clearly.




It sounds like the typical questions of "if human evolved from apes, then why are there still apes?". The answer of course, is that humans did not evolve from modern apes...humans and apes had a common ancestor.

[andros]

so we're going on what we believe and others tell us

Well, to be perfectly accurate, some of us are "going on" a huge body of evidence collected in a scientific manner by a large number of researchers. And others of us are attempting to "disprove" evolution based on an imperfect and inaccurate idea of the topic and one biased and flawed work by an author without substantive credentials and a reputation for deception and obfuscation.

Determining who is who is left as an exercise for the reader.

[ren]

sure, theoretically, a tortis can make it across the road. It's chances are damn slim. IE, chances of evolution are damn slim (the author assumes you got the point and doesn't spell it out like that in the book).


OK, then, using the same logic:

There are 267, or 10,460,353,203 different combinations of 7 letters (not even counting capitals and lowercase as different, or including punctuation).

so the odds of you choosing "HideoHo" as your user name are incredibly small. Therefore, using the same logic, I conclude that it is highly unlikely that you are really "HideoHo", and in fact, you probably don't exist.

Now can you see how foolish this argument is?

[lissener]

Originally posted by Phobos
It sounds like the typical questions of "if human evolved from apes, then why are there still apes?". The answer of course, is that humans did not evolve from modern apes...humans and apes had a common ancestor.
. . . or, if evolution were true, why aren't rabbits green?

To which I always say, "Why can't they fly? or swim? why don't they have humongous, venomous fangs? Because they work." Or something probably a lot more well thought out and eloquent.

[Unauthorized Cinnamon]

Opus1, that was excellent. I shall also use your language analogy, if I may.

It appears that the talk.origins archive is down right now, but here is a nice compilation of the criticisms of evolutionary theory and answers here http://www2.uic.edu/~vuletic/cefec.html . #4.12 describes one example of observed speciation, and links to the talk.origins pages for more (I guess we'll have to wait for that to be up and running, but this is a good start).

[andros]

The chances of the spontanious life occurance

One more time: Biogenesis is unrelated to evolution.

We've been working with bacteria for years, growing it and had millions of generations yet we've not seen advances in these bacterias other than having immunities to certain antibiotics.

Huh? Let's see . . . firstly, speciation occurs in nature, not in a petri dish. Secondly, are the development of immunities not indicative of selection? If not, why not?

Thirdly, speaking of biochemistry, can you please find out for me how Creationists explain protein homology? Thanks.

[Phobos]

Originally posted by HideoHo
Unfortunatly, I have work to do, so this is the last post today.

The chances of the spontanious life occurance was calculated as 1/ largest number ever (number of times every hydrogen electron has gone around it's nucleous since the beginning of time) and while this is still a chance, not a statistically possible one. Again, being at work, I don't have which book this is from, though I can get that for you.

Another point of contention, I'm thinking in too large of a step. At what point does a single cell organism go to two or more cells? We've been working with bacteria for years, growing it and had millions of generations yet we've not seen advances in these bacterias other than having immunities to certain antibiotics. Why?

Anyways, I'll see you later, try not to flame to so hard that I gotta look this thread up in the pit later.


(1) Your first point was already addressed. We cannot accurately calculate the odds of abiogenesis when we do not know how it occurred. But, it did occur. Plus, the calculations themselves are debateable.

(2) Your second statement is false. We have seen changes in bacteria other than new immunities. Even so, new immunities developing in a bacterial population is part of evolution.

(3) Hopefully, this won't evolve :) into a flame thread.

[Nen]

Originally posted by HideoHo
A large part of evolution is at what point can a single species no longer mate with itself and become another species?

Is the above sentence a statement or a question? If it is a statement, speciation is not a "large part" of evolution. Speciation is simply a distinct point in the process of evolution.

Originally posted by HideoHo
There was the idea of two different species making a third.

Who offered that hypothesis? Two different species cannot produce live and fertile offspring, e.g. the horse and the donkey produce the sterile mule.

Originally posted by HideoHo
If we came from monkeys, why aren't we backwards compatable?

Although we share a large portion of DNA with various primates, 98% with chimpanzees for example, we remain different species. By the definition of the term species, we cannot interbreed.

Originally posted by HideoHo
Who was the first person that couldn't have sex with his peers?

Consider this postulation of human phylogeny. Ardipithecus ramidus evolved into australopithecus afarensis (e.g. "Lucy") which evolved into two species. One species was australopithecus aethiopicus which evolved into australopithecus robustus and australopithecus boisei. These species became extinct. The other species was australopithecus africanus (e.g. the "Tong baby"). Eventually homo habilus came into being, followed by homo erectus, then homo sapiens.

Originally posted by HideoHo
If it was a whole area that had it's apes evolving into humans, why did there still seem to be chimps in the same areas as the first humans at the same time?

Technically, homo sapiens came into being approximately 250,000 years ago--Chimpanzees and humans were already incompatable. Chimps were evolving under separate conditions. Between fifteen and five million years ago, the tropical forests of the Sahara receded and gave way to the savannah. Due to a lack of natural arboreal habitat, some primates were forced to become more terrestrial. Due to a change in terrain, i.e. arboreal to terrestrial, bipedal locomotion and upright posture became an advantage in survival. Due to a change in diet, the land apes (ardipithecus ramidus) developed more enamel. As speciation continued, protruding canines receded and the surface area of molars increased. Many other characteristics changed as well.

The point is that at one time there were two populations of a single species. Environmental pressures were different for these two populations. One stayed in the arboreal environment while the other was forced to adapt to new conditions. As gene frequency changed between the two populations, the two developed different phenotypes. Eventually, the two populations became different species. While one hominid branch evolved into our species, another branch ended (as is the case of australopithecus robustus). Ardipithecus ramidus shared a common ancestor with the chimpanzees of the time. Both branches continued but were subject to different pressures, ergo, modern chimpanzees and modern humans developed separately.

[Mauve Dog]

Originally posted by HideoHo
The chances of the spontanious life occurance was calculated as 1/ largest number ever (number of times every hydrogen electron has gone around it's nucleous since the beginning of time) and while this is still a chance, not a statistically possible one. Again, being at work, I don't have which book this is from, though I can get that for you.

Statistical improbabilities are largely meaningless, as has been addressed in previous posts in this thread. Unless it can be shown that spontaneous life generation is impossible, this is a moot point. Life exists, so regardless of the odds, it happened.

Besides, I am pretty sure that most of these probabilites do not take into account the actual chemical properties of the molecules involved. Certain molecules have an affinity for certain others, making it far more likely that Molecule A will join spontaneously with Molecule B. Molecule C may not have much affinity for either A or B, but may have an increased affinity for the A-B combination. If this were not the case, it would take an incredible amount of sustained energy to keep any two atoms together. And that's not how the universe works.

Another point of contention, I'm thinking in too large of a step. At what point does a single cell organism go to two or more cells? We've been working with bacteria for years, growing it and had millions of generations yet we've not seen advances in these bacterias other than having immunities to certain antibiotics. Why?

For one thing, bacteria don't reproduce sexually for the most part. They may exchange genetic material, but that isn't quite the same thing.
As for the single->multiple cells, many single-celled organisms reproduce via cell division. If such an organism formed a colony, it's not a great step from there to cell differentation (certain cells develop certain traits which allow them to specialize in a given function, (e.g., food gathering or mobility), and voila, you have the beginnings of a multicellular organism.

Evolutionary change is composed of baby steps over a great length of time (if you even think you have a concept of how long a billion years is, or even a million...you don't), not gigantic leaps from amoeba -> man.

[Mooney252]

>Most people use the England moths as an example of
>evolution, with their changing colors due to pollution.
>Which moth is more evolved, however? <

I really didn't want to jump into this, but as the man-in-black (played by the Governor of Minnesota) in an X-Files episode called 'Jose Chung from Outer Space' summed it up:

"Your scientific illiteracy makes me shudder."

The notion of "more evolved" is a complete misunderstanding of Darwin's theories of natural selection, which have been amply demonstrated in the fossil record. Darwin says taht it is only a question of living things being better adapted.

Stephen Jay Gould in his book "Full House," as well as in other writings, attacks the egocentric notion that evolution leads to higher and higher orders of complexity or perfection -- as human philosophers have long posited.
In recent years Gould's main concern seems to be that humans continue to believe that they're the "highest" form of life -- and the arrogant philosophy that results. As he correctly indicates, bacteria have won the evolutionary battle based on count and diversity -- and they'll be here until the sun becomes a nova. Can't say that for homo sapiens.

Read and understand evolutionary theory before trying to find metaphysical reasons that it doesn't "work."

[Nen]

By the way, Opus1, I'm in agreement with lissener on the language comparison.

[tracer]

HideoHo wrote:

What I am looking for is proof [ ... ] or someone to setup a lightning machine in some distilled water and make life.

This has very nearly been done!!

In the 1950s, Fox and Miller discovered that electrical discharges ("lightning") could turn the basic chemicals once thought to exist in Earth's atmosphere -- methane, ammonia, and water vapor -- into amino acids.

It was later discovered that amino acids baked in ultraviolet light ("sunlight") would turn into short, protein-like chains called proteinoids.

Finally, Fox discovered that if you put a hot lump of proteinoids in a dilute saline solution ("ocean water"), it would spontaneously give off these little thingies called proteinoid microspheres (http://www.siu.edu/~protocell/).

Proteinoid microspheres have so many properties in common with real, living bacteria it's not even funny. They "eat" and "grow" in that they absorb more proteinoids from their environment. They even undergo a process of "division" eerily similar to cell division. If they had DNA, or even RNA, we wouldn't hesitate to call them "alive."


Note that the matter of abiogenesis still isn't completely settled, though. Another candidate for the progenitor of living cells is the "coacervate," and another possible (though much less likely) candidate is the "liposphere." But for my money, if I had to bet on one of them, it'd be the proteinoid microsphere, hands down.

[Philster]

Reminds me of the ending of the movie Diner...Paul Reiser's character is not buying the evolution theory...goes something like this:

"...Millions of years ago, in a swamp, their was an amoeba, and this amoeba crawled onto land, and now we have some guy on the corner in a winter coat yelling, 'Taxi!'....???"

Ummm...not quite...:)

[Philster]

Anybody got a banana? I think I'm becoming less evolved...

[Stylus]

So HideoHo you want bacteria to turn into people (or some other "higher" vertebrate) don't you? Well I don't think that's going to happen. You see, bacteria are nearly perfect, for what they are! Their genomes are just to small to allow for any "evolutionary leaps". However, your genome and the genomes of all those other "higher, more evolved" creatures (compared to the lowly bacteria that has only been here since the beginning and shall be here till the sun turns into a red giant) have REDUNDANCY and so CAN "evolve". Did you know that some bacteria have a doubling time (one bacteria turning into two bacteria) of under 20 minutes!! Do you know how many spontaneous mutations can occur within a population of bacteria, with a 20 minute doubling time? You mention that bacteria have only evolved resistance to some antibiotics. As fast as they mutate it's suprising they haven't become resistant to ALL antibiotics already. The cool thing with bacteria is they not only produce "new" bacteria capable of antibiotic resistance, but they keep the "old" ones as well!! THIS IS THE AGE OF BACTERIA HIDEO!!!! ALWAYS HAS BEEN AND ALWAYS WILL BE!!!

I could go on about bacteria, but I'd like to throw something else your way. Since you can't seem to comprehend how a photosensitve cell could turn into an eye, do you think you could understand how a few jaw bones could become hearing ear bones? It's amazing how some gill supports could become jaw bones, could become ear bones. Let me know if you'd like to learn more, and then we can take a spin on that wild ride!!!

[Triskadecamus]

HideoHo,

This is a very different audience than you are used to. The book is not too detailed or complex for many people on this board, it is to simplistic, and elementary. The startling conclusions you have just learned about have been brought up more than a dozen times each on previous threads. I won’t bother to link you to death with references.

But do be very careful about assuming that your information is more accurate, erudite, or consistent than that available to the posters on this board. The hard facts are that many people who respond here are far better read than you and I on the subject of Darwin’s Black Box. It isn’t a black box to them, they work every day mapping and manipulating the very stuff of genes, and evolution. Telling them what the relative probabilities of something happening is mildly humorous, at best.

Protein homology has been mentioned several times. This question will come up over and over if you preach evolution by design, or Creationism, or denial of evolution, or any of the many other anti-Darwin philosophies here. The really funny part is that most Creationists don’t understand what the words mean, and explaining them involves six or seven months worth of Molecular Biology classes at a good University, or a few years keeping up with the news of Science.

The Eye was evolving long before it was an eye. Plants show phototropism. The sun dominates life above the deeps of the ocean, and any improvement in an organism’s ability to use light can have a benefit. The Human eye is not all that good a design, either, if you really examine it. Put the blood vessels behind the retina, add flow through filtering in the interior fluid, and move the fovea away from the visual field, and you are talking design.

Missing links is a useless term. We have lots of examples of variation within species, and lots of examples of genera of individual species which are essentially similar in both taxonomy and biochemestry, (that ol’ boogey man protein homology) while dissimilar in sufficient amount to be designated divergent species. There are even examples of species that are infertile among members at the extreme limits of their range, but fertile within closely neighboring individuals. There are also examples of bird species that are genetically isolated by behavior alone, and yet show the genetic results of that isolation. Those are as much “missing links” as the much-discussed man/monkey. But they aren’t missing links, they are simply living organisms, which either will or will not procreate before death.

Species is an artificial division. So are Genus, Phylum, and Kingdom. The division is an imposed system. When we find an exception to the system, we examine it closely, and may change the system. Infertility is not an unchallenged definition of separation for species. There are several different and highly competitive methods for taxonomic assignment under current use. The phenomenon of life does change over time, and imposing our system upon it helps learn what life is, and how it changes.

To claim a particular inaccuracy exists within the current model of evolution is certainly a point of valid importance to biology. Evidence of such an inaccuracy would be received with a great deal of interest, and independent examination. However to assert that the entire model is incorrect is a profound claim, and would need extensive hard evidence to be given any credence at all. Many decades of investigation and effort support the current model, and many investigations have proven it to be consistent. Yet every day someone on the Web announces the imminent demise of Darwin’s theory. Most biologists don’t even read the articles. If you want your own voice to be treated differently than the voices of those who replace scholarship with stridency, you must show exemplary scholarship, and openly available evidence. So far, that is still lacking.

I reiterate the warning attributed to me here, the heathens at The Straight Dope Message Boards are really smart.

Tris

[Dinsdale]

Just want to thank you all for the interesting discussion. Sorry I was elsewhere earlier this afternoon (not that this lawyer would have added anything significant.)

One thing I thought of concerning Hideoho's observation that the numbers were too big (or the odds too small) to be believed -- I had a similar problem when Mrs. D started getting seriously into astronomy. "How many light years did you say, dear?" Unfortunately, lots of hard science doesn't "dumb down" all that well. After a certain point you have to accept some of it (dare I say it) on faith.

Excuse me now while I go to quart.

[Ben]

Originally posted by HideoHo
Also, glad to see a few people arguing in a serious matter, and the fact that no one here is a Biochemist, or God (right?) so we're going on what we believe and others tell us, not our own experience, so you can't make me take insults personally so nyaaaa :-P

What an odd assumption- why do you think that no one here is a biochemist?

Would it be unduly harsh of me to point out that this is SDMB, not LBMB?

Anyway, since you have read this book on the *biochemical* evidence against evolution, and since protein homology (thanks, andros!) is a major piece of *biochemical* evidence *for* evolution, and since Behe would therefore have been deeply remiss in not addressing protein homology, then you know all about it, right? So why not quote the parts of Behe's book which explain why protein homology isn't really evidence for evolution?

Why don't you at least *acknowledge that you have been asked to explain protein homology*? You've been asked three times now, fer Pete's sake! Either put your money where your mouth is, or admit that you have no idea and Behe has no case!


-Ben

[Badtz Maru]

Someone brought up how random mutation could only change one or two genes, not the great number that would be needed for a major structural change.

I am definitely not an expert or particularly well read on genetics, but I read an explanation about how changing one tiny part could rewrite a whole string of genetic data.

As an analogy, consider this string of letters as representative of a gene.

AGCATAGAAGCCTAGGATTTACGGAGA

Now, say only one of these letters can be changed, dropped whatever. That's not going to make a big difference in the information the gene expresses.

Wrong. That string of information is subdivided into groupings of those elements, the groups are what's important - in a sentence it's the words that are important, not the individual letters. So let's say these bits of information are grouped into threes.

AGC ATA GAA GCC TAG GAT TTA CGG AGA

AGC means one thing, ATA means another, etc.

Now a random cosmic ray knocks one of these letters out, let's say the first T. It is STILL going to be grouped into threes, not the same group of 9 'words' with one being a letter short.

Take that T out, and you get this instead...

AGC AAG AAG CCT AGG ATT TAC GGA GA

By removing that one letter, you have changed most of the 'words' in the sentence, making it mean something completely different. One minor change has rewritten the entire thing.

[JonF]

The author puts in a good analogy: Say you have a 20,000 lane highway with heavy traffic zipping along at 100mph. Suppose a tortis is at one end and crosses the road. Theoretically, the tortis will make it...

It's a terrible analogy. It's even a terrible analogy in the way that Behe actually proposed it.

You should read "Tower of Babel", Robert T. Pennock, ISBN 026216180X. He discusses this flawed analogy on pages 168 and following.

Individuals don't evolve; populations do. So your one tortoise is not realistic. Evolution takes time and generations, so your tortoise shouldn't be expected to make it across the highway; maybe its descendants could.

Consider it with the animal that Behe used, groundhogs, and think of it with 100,000 groundhogs. They cross the first lane; the slaughter is terrible. But some of them are just plain lucky, some [b] pause between lanes 1 and 2 and breed back to a population of 100,000/.b]. Then they set out across lane 2. Again the slaughter is terrible, but a few make it across.

Repeat for all lanes, letting the population breed back to 100,000 groundhogs between each pair of lanes. By the time they are crossing lane 10,000 most of them are good at dodging and/or jumping, and some of them are smart enough to wait until cars aren't coming. A good large portion of them make it across [/i]because they are the descendants of groundhogs that each made it across one lane[/i], and there's been selection for groundhogs that have some method of doing that.

By the time they cross lane 20,000 they are artful dodgers, or look for cars and don't start across the lane until no cars are coming, or have developed tremendous muscular legs with which they jump across the lane above the cars in one bound, or something. But almost all of them make it across.

[JonF]

As a matter of fact, this book is non-religious. Sorry to burst your bubble.

Think about whether the book is really not religoius or is a religious book in the disguise of a scientific book.

Have you browsed Behe's Empty Box (http://www.spacelab.net/~catalj/box/behe.htm) and A Few Links about Michael Behe & DARWIN'S BLACK BOX (http://www.cbs.dtu.dk/dave/Behe_links.html)?

[JonF]

. . . There was no first person who couldn't have sex with his peers, because speciation is ususally a group, rather than individual thing. Think of language changes over time. Old English is practically unrecognizable and incomprehensible to us Modern English speakers. So, who was the first person who spoke so differently that he couldn't communicate with his peers? . . .
I'ma plagiarize that one. Very nice.

lissener, I bet you'd like Tower of Babel (http://www.amazon.com/exec/obidos/ASIN/0262661659/qid=969668337/sr=1-1/002-5058559-9139208); he devotes most of chapter 3 to a discussion of the analogies between the evolution of languages and the evolution of species.

[JonF]

The chances of the spontanious life occurance was calculated as 1/ largest number ever

Yup. And it was caclulated wrong. There's several discussion of this at http://www.talkorigins.org (which seems to be down right now, or I'd post a link right to it). And it's irrelevant (though somewhat related) to the theory of evolution.

You should do dome more homework. I've read Behe; what have you read by his critics?

[JonF]

... one biased and flawed work by an author without substantive credentials and a reputation for deception and obfuscation.

To be fair, Behe does have substantive credentials. And his reputation is perhaps relevant and perhaps an ad hominem irrelevancy.

[JonF]

Please please please someone explain that tortise analogy to me. I'm very confused

The idea is that evolution is analogous to one animal trying to cross a highway. It's confusing becasue it's such a lousy analogy.

Behe's explanation of it isn't very good, so I'll post Pennock's explanation with enough Behe to give you the flavor:

In a chapter entitled "Road Kill," Behe replays the story of unbridgeable chasms, this time with a tale of a groundhog trying to cross lanes of traffic, which purportedly illustrates a problem for evolution. He begins with a description of the automotive dangers groundhogs face even on a quiet rural road.

"Usually you're driving along. . . when all of a sudden a small, round shape waddles out of the darkness into your lane. At that point all you can do is grit your teeth and wait for the bump. . . . The next morning all that's left is a little stain on the road, other cars have obliterated the carcass. Nature red in tooth, claw, and tarmac."

In Behe's next image the road has turned into the Schuylkill Expressway which is "eight or ten lanes wide in certain stretches" with thousands of times the volume of traffic. One can predict the next extension of the metaphor.

"Suppose you were a groundhog sitting by the side of a road several hundred times wider than the Schuylkill Expressway. There are a thousand lanes going east and a thousand lanes going west, each filled with trucks, sports cars, and minivans doing the speed limit. Your groundhog sweetheart is on the other side, inviting you to come over. You notice that the remains of your rivals in love are mostly in lane one, with some in lane two, and a few dotted out to lanes three and four; there are none beyond that. Furthermore, the romantic rule is that you must keep your eyes closed during the journey. . . . You see the chubby brown face of your sweetie smiling, the little whiskers wiggling, the soft eyes beckoning. You hear the eighteen-wheelers screaming. And all you can do is close your eyes and pray."

This supposedly illustrates a basic problem for gradualistic evolution, which would maintain that the highway was not crossed all at once but one lane at a time. Behe says he has a better explanation-God's intelligent design. Better? Let us put it in terms of Behe's story to see how the intelligent-design "theorist" must imagine how the groundhog crossed this uncrossable highway. According to IDCs, God's design is necessarily for a purpose, so we must suppose that the groundhog and his sweetie must literally have been a match made in heaven. Taking Behe's metaphor to its logical conclusion, what his alternative "explanation" comes to is just this:

God must have sent down Cupid to fly the lovesick little fellow over to his sweetie. Even if we were to agree that the odds were greatly stacked against the groundhog's crossing the highway on his own, surely this is still a more reasonable working hypothesis than to jump to the conclusion that he got across by some divine airlift.

[tracer]

Opus1 wrote:

There was no first person who couldn't have sex with his peers,

Then why is it so difficult for me to get laid?

Wait, don't answer that....

[DrFidelius]

Damn, I have to work late trying to get four hundred seperate sites ready for a new drug study, and everyone else says everything I would say...

Behe's argument from Irreducible Complexity is flawed because he does not take into account that an elegant system could be the pared down remnant of a less efficient system. He proposes a rather clever argument from ignorance wherein he says, in effect, "I cannot figure out how this could have evolved through the addition of elements, therefore it must have been designed by an entity far more intelligent than I."

And if you start out with single celled eukaryotes, and an empty ocean, eventually some of the colonies will act as communal organisms to the detriment of some of their singleton neighbors. Once that starts, selection will form better multicellular organisms.

And if you start out with a million tortoises, a few of them will be lucky enough to cross the road.

[DrFidelius]

tracer


Then why is it so difficult for me to get laid?

Wait, don't answer that....

the question concerned your peers, and as we know, your peers are also pathetic geek-boys.

Sorry to have to point that out.

[Palm Cove]

I can't help noticing that there is only one creationist participating in this thread.

Could it be that you have all been snared by a troll?

I suggest that creationists provide the same breadth of evidenceto support their "theory", that they demand of those who accept evolution as a given.

Might I recommend also Matt Ridley's The Red Queen - Sex and the evolution of human nature.

It may help OPer understand evolution's influence on his thinking (I'm not being abusive here)

It may also help tracker understand lack of getting laid

[JonF]

I find it interesting to consider the title of this thread: "Why it isn't evolution - proof against Darwin".

It appears to me that the only proof that has been offered is Behe's fallacious "I can't conceive of how it happened, therefore it never happened".

Note that Behe has not proposed his theories in any scientific forum (The Elusive Scientific Basis of Intelligent Design Theory (http://www.natcenscied.org/id17-3.htm)).

[JonF]

Could it be that you have all been snared by a troll?

HideoHo hasn't shown any particular trollish characteristics, and I think it's unfair to use the word. He/she appears to be misguided and ignorant, but not malicious.

[Kimstu]

tracer replied to opus1: "There was no first person who couldn't have sex with his peers,..."
Then why is it so difficult for me to get laid?

Maybe you're just too highly evolved. That's it, you've speciated as an individual! Gosh, tracer, you'll be famous! I can see it now, the book contracts, the talk shows, the groupies---ooops, well, so much for that. ;)

[Akatsukami]

DrFidelius writes: Behe's argument from Irreducible Complexity is flawed because he does not take into account that an elegant system could be the pared down remnant of a less efficient system. He proposes a rather clever argument from ignorance wherein he says, in effect, "I cannot figure out how this could have evolved through the addition of elements, therefore it must have been designed by an entity far more intelligent than I."
I suppose it would inappropriate to point out that, since the "designer" consists of random and non-sentient forces, Behe's argument is in fact correct? :)

[DrFidelius]

Why does the tortoise cross the road?

In the real world, the tortoise (or its descendants) which survive are the winners, no matter whether they crossed the road or not. Descent with modification is not goal oriented.

It is easy and quite human to look back and wonder how unlikely a path leading to a particular situation may be. This overlooks the point that ANY GIVEN SITUATION is equally unlikely. When one shuffles a deck of cards, the chance of any given order arising is slight. BUT, an order will be there, and saying that it is unlikely does not make the cards disappear, or alter the mechanisms of the shuffling.

[The Ryan]

Originally posted by JonF
Could it be that you have all been snared by a troll?

HideoHo hasn't shown any particular trollish characteristics, and I think it's unfair to use the word. He/she appears to be misguided and ignorant, but not malicious.
Well, he (and considering the name "John" at the end of his first message, I think that it safe to assume that this poster is male) did say:

Having read the book, I do know that it's not religous, but scientific in nature. As it appears, I've come to an argument that's met with rebuttles that I'm just a religious nut and therefore have no say.
Which implies that people on this board have called him a religious nut. Unless he can give an example of such an occurrance, this looks like the classic "whoever disagrees with me is biased against anyone that disagrees with them"/"all of your arguments have been simply ad hominem attacks" ploy. Not exactly the attitude of someone looking for an honest debate.



Oh, and Mooney252: the title of the X-Files episode was "Jose Chung's 'From Outer Space'". Jose Chung wrote a book called "From Outer Space", and the apostrophe s denotes a possesive.

[Sterra]

Looking at this thread its not exactly hard to think that people are calling him a religious nut. Its because of people who gloat and say "if you have misconceptions about evolution you are a religious nut":)

[edwino]

A little story. As I am a dork.

Once, there was a man by the name of Walter Gehring at the Biozentrum in Basel, Switzerland. He ran a lab with lots of smart postdocs.

One day about 7 years ago, he isolated a fruit fly that had no eyes. As is the standard with fruit flies, he did the forward genetics to clone a novel gene, which he called eyeless. This proved to be quite a neat gene, as it proved through a number of beautiful experiments, to be close to the master switch gene which turned on eye development. In fact, if he turned it on in wings or legs in the fruit fly, they grew eyes on their wings or on their legs.

As this was such an important gene, he began to look for similar genes in other species. And guess what? He found homologs to eyeless in every species with eyes that he looked at. Planaria (flatworms) with eyespots have a copy. Squid have a copy. Humans have copies, mice have copies. And guess what? If you mutated the mouse gene, they got small eyes. In fact, the gene was named Small eye. And guess what? Some humans had mutations in the gene (called Pax-6), and they suffered from hereditary aniridia, or lack of an iris. And yet, all the proteins were slightly different, depending where on the evolutionary tree they fell. And yet, squid and mouse eyeless copies could still make flies grow eyes on their wings and legs.

Evolutionarily, this demonstrates that something very complex (and varied across species) shares a simple root. Since the first multicellular organisms that developed a group of photosensitive cells, we have had the eyeless system. We still all have it. We started with something simple, and it was advantageous, and we have maintained it. It is an unarguable point to say that a divine creator must have used this system (changed slightly) in all animals to make eyes of TOTALLY different structures (squid, planarian, fruitfly, and human eyes all work very differently) and of TOTALLY different origins (the eye is from the brain in humans and from the epithelium in flies). It does however argue for a simple beginning and branching with different levels of complexity being added in different forms in each branch.

[The Ryan]

Originally posted by Asmodean
Looking at this thread its not exactly hard to think that people are calling him a religious nut.
It certainly isn't hard to do so if one is determined to interpret dissent in that manner. However, if one is objective, there is no reason to think that he has been called a religious nut.

Its because of people who gloat and say "if you have misconceptions about evolution you are a religious nut":)
Huh? I haven't seen that around here.

[tracer]

The Ryan wrote:

Originally posted by Asmodean
Its because of people who gloat and say "if you have misconceptions about evolution you are a religious nut":)
Huh? I haven't seen that around here.

Although I must admit, most of the folks around here that post creationist-slanted misconceptions about evolution do turn out to be religious nuts.


-- tracer, hoping I haven't speciated. ;)

[DrFidelius]

I'm still kinda wondering what version of _Darwin's Black Box_ he read. The conclusions do not seem to be closely related to anything in that book.

Or, it could just show poor reading comprehension...

[glee]

HideoHo,

You said 'The chances of the spontaneous life occurrence was calculated as 1/ largest number ever (number of times every hydrogen electron has gone around it's nucleus since the beginning of time) and while this is still a chance, not a statistically possible one.'

What is the 'largest number ever'? *

When was 'the beginning of time'? **

Assuming that you do calculate a really BIG number (I like googolplexes myself), and decide the chance of something is '1 in a googolplex', then this is indeed the chance of it occurring. It is also statistically possible (I think perhaps you meant jolly unlikely).

* move over infinity, you're history :rolleyes:

** 4004 BC, perhaps, Bishop ;)

[capacitor]

And one more thing, I don't believe in God as depicted in the Judeo-Christian Bible, but I do believe that someone Divine designed the universe, and the Earth. The design is still an ongoing process.

[Ben]

So where the heck is HideoHo, and when is he going to explain protein homology? Didn't he say he was into the biochemical challenge to evolution?

-Ben

[*Michael Hunt*]

Originally posted by HideoHo
Having read the book, I do know that it's not religous, but scientific in nature. blah blah...Oh well.


Wow:) This thread is amusing, methinks.

While I couldn't bring myself to read through the whole thread, it is obviouse the HideoHo needs to do some more reading as the views held in the book in question are not those held by most of the sci. community, I think most would agree.

Granted, there is no "Right" or "Wrong" because no one can go back in time at this point and bring us the whole story.

However, Evolution is a fact. The mechanisms by which it operates are not certain. I find it funny that people STILL are fighting against Evolution in general as there is overwhelming evidence for this. It must be odd to go through life blinded by relgious dogma and such- granted I used to date a woman like this:) It is very amusing sometimes, albeit frustrating.

I would suggest reading: Biogenesis : Theories of Life's Origin by Noam Lahav, if you have questions about microevolution and the origin of life through the evolution of man.. There are also many other references cited in this work.

:D

Chris

[Honesty]

If you ask me,

Both Creationism and Evolution are completely off the wall. One practice massacred millions of people, while the other has shamelessly and selfishly played a deaf ear to anything they couldn't prove with their trinkets and baubles.

Maybe I'm just cynical. In one hand, you have creationism which says that a God from a shimmering cloud came down and created the universe. He talked to people regularly over two thousand years ago, but now he has decided not to communicate verbally to the masses anymore. In the other, you have faux theories that instead of going from the beginning. They put down a sign which reads, "Evolution starts here!" without exploring how nothing came from nothing in the fist place. Besides, the assertion that we came from bacteria is just downright laughable.

Realistically, I suppose I'd have to side with Science. Not because their religious-like fervor is any better than creationism. Just because they haven't been so blatant to impose their beliefs on others.

Sincerely,

An enlightened despot

[andros]

Honesty said:

Both Creationism and Evolution are completely off the wall. [blahblahblah snipped] Besides, the assertion that we came from bacteria is just downright laughable.

You haven't read a single word of this thread, have you?

[Philster]

NOTICE: You have created a paradigm.

Members of contemporary religious sects, creationists, those who get by on "faith"....

You hereby give up the right to claim that anything science theorizes, no matter how bizzare and beyond comprehension it may seem, can never be declared bogus or unbelievable by you or your peers because....and follow along now....because you have already passed on your right to apply logic to anything since you have subscribed to a belief, quite frankly, that is down right unbelievable in itself.

Hmmm..take Christianity...that's one of yer bigger religions, is it not? Well, holy crap, take a look at what you are asked to believe? Some of it is quite unbelievable, is it not( C'mon...be honest)? Jews believe some extraordinary stuff too - and come to think of it, most major religions have extraordinary events bound to their history, many of which are the very basis for faith in the first place! Duh! You can't reject evolution because it's "unbelieveable"!!!

Questioning evolution? Discarding it as a bizzare idea? Can't comprehend how we went from simple cell creatures to some guy standing on the corner in a winter coat yelling "Taxi"? Guess what? Have faith! To discount the theory of evolution because it is pretty incomprehnsible, would mean that, for the sake of consistency, you abandon your belief system as well. Therefor, you must have faith in the theory, lest you be the first in line to discard your own beliefs because they are, well....unbelievable.

Have faith! :)

[Philster]

Originally posted by andros
Honesty said:

Both Creationism and Evolution are completely off the wall. [blahblahblah snipped] Besides, the assertion that we came from bacteria is just downright laughable.

You haven't read a single word of this thread, have you?


Andros...that's hysterical. Let's see if Honesty is honest.

I love when people claim that coming from "bacteria" or simple cell organisms is downright laughable.

Know what I find laughable (for the sake of making a point - not that I find it laughable)? No? Well, I'll tell ya. Someone told me that I grew from just a few cells (which were originally in two separate human beings), and that those cells were coded with this DNA stuff, and the cells kept splitting...and at one time I was merely more than an egg, then I looked like a 2 centimeter chicken, then I looked like a fish, and now look at me - I'm typing on the SDMB!!! Go ME!!!

Honesty, evolution is unbelievable? How so? I think conception and the development of Humans from combined sperm and eggs is pretty whacky! But, damn, it happens! I was just a little ol' sperm and an egg in waiting and BAM! Here I (and all of you) are!!!!! Stick that in your unbelievable bag Honesty!!!!!!!!!!!!!!! :)

Thank evolution for people like Andros. I wonder if Honesty will read this?

[Ben]

Originally posted by Honesty
Besides, the assertion that we came from bacteria is just downright laughable.

Laughable? How else do you explain protein homology?

-Ben

[sugaree]

I am still pondering how, as Honesty said...
Creationism...massacred millions of people I am not sure if even Creationism's most rabid detractors have noticed these massacres.

[Honesty]

Unfortunately,

My hatred for both science (that attempts to explain evolution) and creationism is too massive for me to write a post that isn't riddled with fallacies.

But for now, I will give you a skeleton of my problem.

Evolution doesn't explain how the universe was created. They fail to address how nothing came from nothing. Now your argument might be "But but but, we can only go far so far."

Bull. If Evolution was correct, then not only could it explain the origin of man, but it could explain the start of the universe. Instead, they tack their sign, "Evolution starts here!" while failing repeatedly to delve deeper.

Science militantly shows their platinum deaf ear when anything dealing with metaphysics is shoved in their face. Science is based on theories and conjecture, how can they (evolution science) be presumptuous enough to declare that their theories are more believable than say, John 3:16 in the new testament?

They are both disgustful and disgraceful. Science should simply stay in its place advancing mankind with their discoveries. I truly wish these evolution fanatics would shift their studies in medicine and research. Then atleast, maybe the cure for fatal afflictions like Cancer and AIDs could be cured sooner.

This will probably be my last post on the topic. This subject is really too emotional for me to write a coherent post on.

Regards,

B. Williams

[JonF]

Well, you certainly composed a post riddled with fallacies!

If Evolution was correct, then not only could it explain the origin of man, but it could explain the start of the universe. Instead, they tack their sign, "Evolution starts here!" while failing repeatedly to delve deeper

The limits of the theory of evolution are not artificial. Just because it's called evolution does not mean that it should explain how everything evolves. Would you want it to explain how the contents of your sock drawer change over time?

Cosmology addreses the question of the start of the universe.

Science is based on theories and conjecture

And much more, as has been explained repeatedly in this thread and others.

how can they (evolution science) be presumptuous enough to declare that their theories are more believable than say, John 3:16 in the new testament?

Because scientific theories are testable. Now, the question of what is true rather than what is believable is a different story.

Science should simply stay in its place advancing mankind with their discoveries.

I have no idea what you mean there, but it sure seems silly.

[Myrr21]

Evolution doesn't explain how the universe was created. They fail to address how nothing came from nothing. Now your argument might be "But but but, we can only go far so far."
Bull. If Evolution was correct, then not only could it explain the origin of man, but it could explain the start of the universe. Instead, they tack their sign, "Evolution starts here!" while failing repeatedly to delve deeper.
Good lord...this is one of the largest falsehoods I've seen perpetrated on my vision in a long time. The rebuttals are so numerous and self-evident (plus I'm really tired and lazy) that I don't really feel like including links, but Cecil has covered this, and talkorigins probably has too.

Basic point: evolution has not one iota of anything to do with how anything started. Natural selection really doesn't apply to the formation of planets and solar systems (fercryin out loud, are they going to get digested by a bigger, better adapted galaxy?). Separate ideas, guy. In fact, you don't need one for the other to be true.

As for the origin of life on earth, it's again a separate issue (I know talkorigins has somehting on this). All evolution does is explain how and why things change...specifically living things (and some stuff that's borderline life: viruses, viroids, and whatnot). This is why there's some oddities with things that aren't living per se, like ancient free-floating RNA or protocells or whatever theory you happen to ascribe to.

Rocks don't evolve. Benzene doesn't evolve. Sugar Chains don't evolve. Sugar chains with nucleotides attached...well...maybe...sorta...maybe. It's just a matter of the boundary being a bit hazy (given that it was quite a while ago and all).

[Spiny Norman]

Honesty ? What are you trying to say, here ?


My hatred for both science (that attempts to explain evolution) and creationism is too massive for me to write a post that isn't riddled with fallacies.

Too bad. No free lunch, here - if you have something to say, back it up. If all you have to say is "You're all wrong and I should be excused from defending that standpoint on emotional grounds", then you're not really adding anything toi the debate, are you ?


Evolution doesn't explain how the universe was created. They fail to address how nothing came from nothing. Now your argument might be "But but but, we can only go far so far."

Bull. If Evolution was correct, then not only could it explain the origin of man, but it could explain the start of the universe. Instead, they tack their sign, "Evolution starts here!" while failing repeatedly to delve deeper.

Bull right back at you. Biology & astrophysics are separate sciences.


Science militantly shows their platinum deaf ear when anything dealing with metaphysics is shoved in their face.

Science isn't metaphysics. Some people span both disciplines, most do not. Most scientists leave metaphysics to philosophers. And I really think you owe us some explanation as to why you chose the word "militantly". Care to come up with an example ?


Science is based on theories and conjecture, how can they (evolution science) be presumptuous enough to declare that their theories are more believable than say, John 3:16 in the new testament?

Ehm - because their theories are consistent with the observations ? Because the theories are refined & improved whenever new information as added ? Because the scientific method has proved itself to be the most reliable way of gathering & organizing information about the universe ?


They are both disgustful and disgraceful. Science should simply stay in its place advancing mankind with their discoveries. I truly wish these evolution fanatics would shift their studies in medicine and research. Then atleast, maybe the cure for fatal afflictions like Cancer and AIDs could be cured sooner.

MAN, have you got it wrong. There are no "evolution fanatics" trying to conjure up a final proof of evolution to convince the creationists. Scientists are conducting research to find out how the universe ticks and advancing mankind that way. They can't be tasked with convincing every doubting Thomas out there - that's what the Straight Dope is for.


This will probably be my last post on the topic. This subject is really too emotional for me to write a coherent post on.

An anti-evolution drive-by posting ? Now, that's something new :rolleyes:

S. Norman

[glee]

Honesty,

You said 'Science is based on theories and conjecture, how can they (evolution science) be presumptuous enough to declare that their theories are more believable than say, John 3:16 in the new testament?'

Well there is a lot of physical evidence to back up the theory of evolution. Also, as with all scientific theories, as soon as something contradicts the theory, you form a new one. (We now theorise the sun doesn't revolve around the Earth).

The Bible verse you mention says that God sent His son to the world, and that believers in Him will have eternal life.
Unfortunately we have no physical evidence for either claim.
Yes, Jesus existed (and gave some wonderful moral teachings). However it was only 30 or so years after his crucifixion that the claim was made that he had risen from the dead.
Similarly noone has ever come back from Heaven to convince the rest of us.
I'm not decrying your personal faith, but you should realise that there is an incredible gulf in physical evidence between your two comparisons.

[Dinsdale]

______
My hatred for both science (that attempts to explain evolution) and creationism is too massive for me to write a post that isn't riddled with fallacies.
_____

Hating both (massively, at that), what is left?

_____
Science should simply stay in its place advancing mankind with their discoveries.
_____

Thank you, Honesty. My otherwise drab morning was brightened by an amusing mental image of Thomas Edison (insert scientist/imvemtor of your choice) being told, "Don't worry about what may or may not have been figured out historically. Just go on out there and advance mankind with your discoveries."

[Ptahlis]

Originally posted by Honesty
This subject is really too emotional for me to write a coherent post on.


That is at least living up to your handle.

One thing that never fails to amaze me is how often, and repeatedly, deniers demand from evolution things that it never claims for itself. Among these are the beginning of the universe, the beginning of life, an animal giving birth to a new species, and the mythical missing link. When these fail to be produced, deniers inexplicably take this as a sign of weakness. It's as sensible as proclaiming the dictionary to be weak or faulty because it doesn't contain the proof of Fermat's Last Theorem.

[Joe Malik]

Remember that biological evolution is a very complicated subject, so much so that many sub-specialties have evolved (pun intended) within the scientific community. I hear all too often, "But Darwin had no idea where the eye came from." A lot of smart people have been born since Darwin and have added more than a few ideas of their own. We apply his name to the overall field not because he was a prophet and handed down the whole truth but because he originated the basic concepts that scientists have since greatly improved.

[Joe Malik]

(Since the other posters are carrying the main torch far more ably than myself)

Behe's fallacy is not an argument from ignorance. He is entirely correct in deducing that complex, interdependent structures cannot evolve by addition of features. Rather, he has accepted a faulty premise, to wit: structures can evolve only by addition.

The refutation of this premise is trivial and comprehensible by a normally intelligent twelve year old. I am continually astounded not only that people waste their time and money reading this book, but that Behe displays his staggering stupidity and lack of comprehension of elementary logic to the world by writing it.

[pldennison]

I truly wish these evolution fanatics would shift their studies in medicine and research. Then atleast, maybe the cure for fatal afflictions like Cancer and AIDs could be cured sooner.

Uh, as it happens, it is the continuing study of evolutionary biology at those levels that often leads the fight against disease. Or do you think the search for gene-level treatments for disorders is a waste of time?

[xenophon41]

Just FYI, but an appropriate hijack here. A few months ago I saved a post (http://boards.straightdope.com/sdmb/showthread.php?threadid=25508&pagenumber=2&postid=478308) in GD that I thought quite eloquently summed up another poster's arguments. ------>

Hansel said:
My point was that Honesty's mind isn't open. He has already rejected science and religion; when he discusses it, he presents a caricature of a zealot, not a picture of a scientist. Unless he opens his mind a bit, then he's asked nothing more than for other posters to assault the high walls of his forcible disbelief so he can be sure they're secure.


(Haven't seen Hansel around lately...)

[Mauve Dog]

Originally posted by Honesty
My hatred for both science (that attempts to explain evolution) and creationism is too massive for me to write a post that isn't riddled with fallacies.

Regrettably, it appears that your hatred arises from your ignorance about what science, and specifically, evolution, is all about. And the fallacies in your post abound....

Evolution doesn't explain how the universe was created. They fail to address how nothing came from nothing. Now your argument might be "But but but, we can only go far so far."

Evolution is not meant to explain how the universe was created. Darwin wrote The Origin of Species, not The Origin of the Universe. As others have pointed out, there are separate fields of science which do address this issue. Cosmological beginnings are outside the purview of evolution.

Bull. If Evolution was correct, then not only could it explain the origin of man, but it could explain the start of the universe. Instead, they tack their sign, "Evolution starts here!" while failing repeatedly to delve deeper.

Bull. See above.

Science militantly shows their platinum deaf ear when anything dealing with metaphysics is shoved in their face. Science is based on theories and conjecture, how can they (evolution science) be presumptuous enough to declare that their theories are more believable than say, John 3:16 in the new testament?

Science deals with interpretation of observations and facts, not analysis of faith. Scientists can claim their theories are more believable than, say, John 3:16 because they have evidence to back up their claims.

They are both disgustful and disgraceful. Science should simply stay in its place advancing mankind with their discoveries. I truly wish these evolution fanatics would shift their studies in medicine and research. Then atleast, maybe the cure for fatal afflictions like Cancer and AIDs could be cured sooner.

This is an interesting statement, since you have previously implied that scientific discoveries are mere hokum in the first place!

Honestly, Honesty, your hatred of science in general and evolution in particular is not based on any sort of rational thought. You would do well to research a topic before attempting to rail against it.

[ren]

I hate science = I'm afraid of what I don't understand

I don't understand = It must be wrong

Sigh.

The failure to understand a scientific theory is a failure of the imagination, not a failure of the theory.

The acceptance of creationism is based largely on its ability to piggyback on a nice, comforting story about our ability to transcend mortality. Evolution certainly does not have that going for it!

Of course, these thoughts have been repeated hundreds of times and hundreds of ways, on this site and elsewhere.

[Honesty]

<sigh>

Admittedly, I'm close-minded on this issue. Both Science and Religion have painfully left a sour taste in my mouth. They fail to address various issues that I brought up in my previous posts. Sadly, nothing you can say can change my stance on this.

I am passionate about this issue for private reasons I will not disclose here. But do know that in any other topic, I'm very flexible, and usually downright nice. Yes, I suppose you can call me a bigot. ;)

Regards,

B. Williams

[Philster]

This thread should be closed.

The issues:

a. have been beaten to death
b. require intelligent bantor about the subject
c. have taken a back seat to the fact that the thread starter and sympathizers are ignoring any points made, albeit points made many times before.
d. makes me want to read through an evolution/creationism discussion that at least exchanges good points and provides supporting evidence, theories and other intelligent dialogue.

[Satan]

Originally posted by Honesty

Admittedly, I'm close-minded on this issue.

Then fucking leave.

Both Science and Religion have painfully left a sour taste in my mouth.

Then fucking leave.

They fail to address various issues that I brought up in my previous posts.

All issues that were addressed, but because you enjoy being willfully ignorant and in fact seem to revel in your ignorance, it does not matter, does it.

Then fucking leave.

Sadly, nothing you can say can change my stance on this.

Then fucking leave.

I am passionate about this issue for private reasons I will not disclose here.

Then fucking leave.
__________________
Yer pal,
Satan - Commissioner, The Teeming Minions (http://football.fantasysports.yahoo.com/full/show?lid=39428&page=leaguehome)

I HAVE BEEN SMOKE-FREE FOR:
Five months, two weeks, four days, 19 hours, 39 minutes and 9 seconds.
6872 cigarettes not smoked, saving $859.09.
Extra life with Drain Bead: 3 weeks, 2 days, 20 hours, 40 minutes.

"I'm a big Genesis fan."-David B. (Amen, brother!) [/B]

[Rysdad]

Originally posted by Honesty
Admittedly, I'm close-minded on this issue.

<snip>

Sadly, nothing you can say can change my stance on this.



Although you may be "very nice" and "flexible," Great Debates is definitely not the place for you.

[Phobos]

Originally posted by Satan
Then fucking leave.


The smoke-free days are starting to take their toll! :)

But once again, Satan brilliantly gets to the point in as few words as possible.

[tracer]

pldennison wrote:

I truly wish these evolution fanatics would shift their studies in medicine and research. Then atleast, maybe the cure for fatal afflictions like Cancer and AIDs could be cured sooner.

Uh, as it happens, it is the continuing study of evolutionary biology at those levels that often leads the fight against disease. Or do you think the search for gene-level treatments for disorders is a waste of time?

You'd be surprised what some people think.

Once, a Creationist e-mailed me to say that the rise of antibiotic-resistant bacteria was not evidence for evolution!

[Ben]

Hmmm... HideoHo was so eager to discuss Darwin's Black Box, I wonder what could have happened? He seems to have totally disappeared.

-Ben

[DrFidelius]

Maybe he didn't expect to run into people who have actually read the book, instead of excerpts and commentaries on Cretinist websites, and who could clearly state why Behe's little musings are in no way "proof against Darwin".

Or maybe his supervisor found out that he was spending his time at work posting to Message Boards and had his proxy revoked...

[Lemur866]

It just goes to show you. The only anti-evolutionists who have the stomach to go toe-to-toe with knowledgable people are those who are religious fundamentalists. Every "creation science" idea can be debated and refuted. Those who try to use "creation science" find themselves demolished and leave. Only the "God said it, I believe it, that settles it" crowd can take the heat.

Honesty, you have shown yourself to be woefully ignorant. "I hate Charles Dickens! After all, his novels don't discuss what it's like to be an Australian Aborigine!" "Newton's theory of Gravitation must be wrong, because it doesn't explain why I had chicken vindaloo for dinner last night!" Shyeah, right....

Then you claim that you have good reason to reject science, reason, logic, AND religion too, yet you fail to explain WHY. Wait, I know! You must be a solipsist! Yes, you're a brain in a jar, so you believe in last Thursdayism!

ROFLMAO....

[lupulin]

Here are some replies (following the *) I have to a long list of supposed "proofs against evolution" that someone sent to me.

Enjoy!!

-Lupulin


Well, I should be writing my thesis but instead I'm reading through this
list of Eric's:


> Reasons for Creationism vs. Evolution

> Section 1: Cosmology, Astronomy, Planetary Geology

> 1.1: The sun contains most of the mass, but only 2% of the angular
momentum
> of the solar system. If the solar system had condensed from a gas cloud,
> most of its angular momentum would be in the sun.

* This value of 2% sounds way off but I don't have my astronomy books here.
Of course, no reference is given ("Down Mike, down!"). In any event, this
could easily be an oversimplification as, according to current theory about
the origin of the solar system there would have been a lot of material
leftover from the initial disk of material that subsequently got blown away
when the sun achieved the density necessary for thermonuclear ignition.

> 1.2: Most sets of fundamental constants would lead to a universe in which
> life could not exist. Therefore, the fundamental constants of the universe
> must have been fine-tuned by a creator who wished to bring man into
> existence.

* The conditions support life as we know it. That /anything/ about the
current universe (or our solar system or planet in particular) is conducive
to life forms tells us nothing about how those conditions came about! If you
think about this, the very fact that we are here requires that the
conditions around us allow us to be here - it could be no other way!! Note
that the above statement is but one example of grossly over interpreting the
observation cited. Using phrases like "must have been a creator" or "proves
the existence of a creator" or "proves evolution is false" don't follow from
the specious arguments they present. This is seen again and again throughout
this list...

> 1.3: At the present rate of influx of meteoritic dust from space, the
earth
> and moon after 5 billion years should each be covered with a meteoritic
dust
> layer more than 180 feet thick.

* Earth's surface isn't static, there has been constant weathering as well
as geologic upheaval during the Earth's history so it is not surprising at
all that there is not a lot of "meteoric dust" here. Also, apparently little
of the metors that strike the Earth contribute anything at all to the
Earth's surface - the vast bulk of the mass is burned up in the atmosphere.
I don't know about the moon, I'm only an amatuer astronomer and don't know
jack about the geology of the moon.

> 1.4: The 1st law of thermodynamics states that the energy in the universe
is
> constant. The Big Bang theory states that the universe came out of
nothing,
> so it violates this thermodynamic law.

* The first law only applies to the universe /as it now exists/ - it says
nothing about the origin of the universe.

> 1.5: The 2nd law of thermodynamics states that disorder in the universe
> always increases. This means that the universe could not have started in
an
> ordered state unless it was "wound up" by a Creator.

* Again, as with 1.4 it only applies to the universe as it now exists.

> 1.6: The rotation of the Earth has been slowing at a rate of 30 seconds
per
> century. If the Earth were billions of years old, the rotation rate at the
> outset would have been so great that the planet could not have held
> together, much less support life.

* No reference is given to this value of "30 seconds" (which, by the way is
not a rate!).

> 1.7: Quantum mechanics proves the existence of a creator, since there must
> have been some entity external to the universe to observe it and thus
> collapse it into a determinate state.

* This is a ridiculous statement. It is also striking that they often stress
the point that "nothing in science can ever be proven" yet they often say
this or that aspect of science "proves" the existence of a creator - you
can't have it both ways!!

> 1.8: Big Bang theory says the universe came from nothing. But something
> cannot come from nothing, so God must have created the universe.

* No, it says it came from an incredibly dense singularity. Also, the first
law again relates only to the universe as we see it currently. The question
of whether or not we are in an oscillatory universe or not appears to still
be open to debaye. Again, they allow no alternative to their position - God
"must" have created the universe. The old question of "Who created God?"
springs to mind here...
If God has always been then why can't the universe have always been here?

> Section 2: Terrestrial Geology, Radioisotope Dating

I'm not a radio-geologist but here are some comments:

> 2.1: Many test using 14C give dates that are obviously wrong or conflict
> with dates given by other radioisotope tests. For instance, a living
mollusk
> was once shown by 14C dating to be dead for 3,000 years.

* How many? No test is perfect. It is important to know this is a
/significant/ number or not. No percentage is given and no reference. The
HIV blood test gives both false positives and a false negatives but overall
the test is very reliable, useful, and valid. The anecdote given is just
that- an anecdote (unreferenced). Making broad, general condemnations
against radiocarbon dating (or any other scientific technique for that
matter) without backing up that claim by anything more than a couple of
anecdotes is useless. How are we to judge the validity of their claim?

> 2.2: The ages of rocks are determined by the kinds of fossils they
contain,
> but the dating of the fossils depends upon evolutionary assumptions. The
use
> of the old age of rocks to support evolution is thus a circular argument.

* The presence of fossils may provide clues to the age of a geologic
formation but it is not the only source of info (indeed, fossils are not
universally present in rock samples) radioisotopic analysis as well as
positional information are also used.

> 2.3: The rate of decay in the geomagnetic field sets an outside limit of
> 10,000 years for the age of the earth.

* But this assumes we know what the field strength was at t=0 (Earth's
formation) how would we know this??

> 2.4: If the earth were as old as geologists say, uranium decay would have
> put into the atmosphere more helium than we currently find there.

* I believe that helium is thought to escape from the atmosphere into space.

> 2.5: There are places where "older" rock strata lie above "younger" rock
> strata.

* The Earth is very active - tectonic movements induce upliftings and
subductions. We've all seen deformations of rock strata in highway cuts
through mountains, how hard is it to believe that in places this or similar
processes could invert some strata?

> 2.6: Radiometric dating is extremely inaccurate, as is shown by the fact
> that such experiments frequently have error factors of a few million
years.

* Again, no reference. No specifics as to /which/ techniques they are
talking about or /how frequently/ these errors occur. It should be obvious
that what's important here is what is the /magnitude/ of the error? All
measurements have errors. If we are talking about an isotopic ratio method
where the halflives can measure time in billions of years then the error of
a few million is trivial!

> 2.7: Many radiometric dating tests have yielded false results.
Evolutionists
> discard all those that are inconsistent with their prior assumptions and
> keep those that "verify" their theory.

* If true this would of course go against the principles of scientific
integrity. Again, no references are given for this accusation...

> 2.8: Radiometric dating reports the earth to be old only because the
> cataclysmic action of Noah's Flood changed the radioisotope concentrations
> in the young earth.

* And just /how/ would a flood do this?

> 2.9: Noah's flood was caused by the condensing of a vapor canopy that
> contained the waters of the flood. Prior to the flood, the vapor canopy
also
> extended people's lifespans to the huge ages listed in Genesis, because it
> blocked out harmful UV rays.

* We've already discussed this one. P.S. - UV rays are not the cause of
aging!

> 2.10: Niagara Falls is moving upstream at a known rate each year. Its
> current location allows only about 5,000 years since the time it started
> eroding.

* We've gone over this one too.

> Section 3: Origin of Life

> 3.1: The law of biogenesis states that life comes only from previous life.
> Therefore prebiotic synthesis - which states that life first developed
from
> nonliving molecules - contradicts a major law of science.

* As with the First law of thermodynamics, biogenesis applies only to the
conditions /extant today/ - it has no bearing on the conditions of a
prebiotic Earth.

> 3.2: Amino acids in living organisms are all left-handed, but in nature,
> equal amounts of left-handed and right-handed amino acids form, so one
would
> expect them to occur in equal proportions in living organisms if
abiogenesis
> were true.

* Wrong. I think Mike addressed this already.

> 3.3: Nucleic acids cannot replicate without the help of proteins.
Proteins,
> however, cannot form unless specified by nucleic acid sequences. Thus,
> genetic systems could not have started naturally.

* Wrong. There are variuos ways to conceive of a genetic system based on
only one componenet. The other componenet could have become associated at a
later time. The two main componenets listed contribute the following:
nucleic acids : information storage
proteins : catalytic ability. The current best guess is that RNA or
something like it may have been an early genetic system. This is because RNA
has been shown to posess catalytic abilities in addition to information
carying. Or, there may have been intermediate forms that are no longer in
evidence in today's life forms. A great analogy of this is an arch. If you
see a simple stone arch it is hard to see how that system could have come
about - without the entire structure present all at once it does not
function. But, you can easily imagine that during the arch's construction
some sort of scaffolding or support structure could have filled in the arch
til lit was completed then the support is removed leaving no trace.

> 3.4: There are n! ways of an enzyme or DNA strand of n parts forming
> prebiotically. Since the smallest proteins have at least 100 amino acids,
> the chance of forming a particular enzyme prebiotically is at most 1/100!,
> which is small enough to be disregarded.

* This is totally misinterpreting or misrepresenting the role of chance or
randomness in such a process. It ignores the power of selection, the
possibility of building up from smaller structures and modular
recombinations. Yes, it is improbable that any given sequence would form
totally at random but this is not what biologists postulate happened. This
is a common misunderstanding.

> 3.5: Even though the Earth is an open system, the second law of
> thermodynamics still poses an insuperable barrier to abiogenesis, since
> order in an open system will increase only when there is a complex system
> (such as a host of enzymes or a supernatural creator) to influence the
> reactions. An increase in order in the absence of such a complex system
> would be like sunshine causing loose parts in a junkyard to assemble
itself
> into a pickup truck.

We've discussed this ad nauseum. There's nothing wrong with fecreases in
entropy as long as total entropy in the universe increasaes with time.
Again, I'll give the ice formation example - where is the "complex system"
responsible for the local decrease in entropy when water spontaneously forms
ice on my windshield in the mornings???


> Section 4: Biological Evolution, Mutations, Speciation

> 4.1: Chromosome numbers cannot change without producing very harmful
> effects.

* Absolutely untrue!

> 4.2: The perfection of the structures of the various life forms on earth
> clearly reveal themselves as the work of an intelligent designer. Nowhere
is
> this more evident than in the unbelievably complex human eye.

* Perfection?? How are life forms considered to be "perfect?" Even if they
were, how would this "clearly reveal...?" What about rudimentary organs and
other structures?

> 4.3: Evolutionists cannot tell us exactly how most organisms arose. For
> instance, no one can explain what series of mutations could have given
> caterpillars the ability to metamorphose into butterflies.

* This is analogous to the arguments put forward against the fossil record -
if science can't explain everything or show evidence of every single step
then the entire concept is supposedly invalidated. This is a ridiculous
argument.

> 4.4: The genetic variation in populations that allows them to adapt to
> environmental change through microevolution (as revealed in industrial
> melanism and bacterial antibiotic resistance) was deliberately put in
place
> by the creator.

* This is one interpretation but there is no evidence for this. Where is
this mentioned in the Bible? If true, why then couldn't He have used
macroevolution as well???

> 4.5: Homologous features do not prove any ancestral relationship between
> organisms, because all classifications above the species level are
man-made
> and arbitrary.

* No, they are just consistent. The classifications are far from
arbitrary.

> 4.6: Industrial melanism does not demonstrate evolution at all because no
> speciation occurs.

* Ths is utterly ridiculous. Evolution is merely a process and this example
supports that this process takes place. The concept they are trying to
refute here is that the species we see today arose through this process. The
industrial melanism example occurred on a timescale not even close to what
current theory says would be required for speciation. On top of this, the
adaptation to this one relatively small environmental condition wouldn't
even be expected to generate a whole new species!

> 4.7: Mutations are universally deleterious, and thus cannot be a driving
> factor in evolution.

* Also ridiculous - their own #4.6 argues directly against this!

> 4.8: There are plenty of records of mutations causing birth defects, but
> none of mutations causing "birth improvements."

* Also incorrect. There is constant variation generated. Whether or not
these are "improvements" depends upon the selection pressures in the
environment.

> 4.9: The rate of mutation is so small that it could never serve as a
source
> of variation.

* First, mutation obviously serves a s asource of variation. Second, there
are different kinds of mutations that act at different rates and produce
different types and degrees of variation. Third, the consensus of scientific
evidence points to a VERY old Earth so even slow mutation rates could
eventually contribute.

> 4.10: Macroevolution remains unproved because no one has observed it. In
> fact, macroevolution is in principle unobservable, so evolution must be
> unscientific.

* It cannot be /directly/ observed but direct observation is not a
prerequisite for being scientific.

> 4.11: No one has ever seen one species arise from another.

* No one expects to.

> 4.12: If evolution were true, then fish would have evolved into amphibians
> and land animals more than once.

* Not necessarily but who says they didn't?

> 4.13: Sexual reproduction could not have come about through evolution.

* Why not?

> 4.14: There is no evidence for the rapid development of new species.

* ?

> 4.15: Natural selection is tautological: the fittest survive, and those
who
> survive are the fittest.

* No, this /statement/ is tautological though. The process of natural
selection can be demomnstrated. It stems from competition for limited
resources by populations with excess breeding capacity. Populations exhibit
variation. Certain of these variations confer a natural advantage to the
individuals posessing them. Since these (phenotypic) traits are heritable
they will increase in frequency in the next generation. The key is that
variation is constantly being generated otherwise it would be a simple cycle
and no evolution would occur.

> 4.16: Organisms feature numerous "irreducibly complex" structures and
> processes, which could not have developed via small evolutionary steps.
> Evolutionists have not even tried to explain how such structures and
> processes could evolve.

* Wrong and wrong.

> 4.17 Given uniform population growth rates, we can extrapolate backwards
> from today's population to prove that there could not have been humans
> before 10,000 years ago.

* This would only prove that what we typically think of as "humans" existed
that far back. besides, it assummes a constant exponential growth rate but
this wouldn'y have always been the case bnecessarily - think of the lag time
your yeast starter goes through before it begins exponential growth. Also,
don't such estimates clash with most fundamental creationists' expected age
of the Earth of 6000 years? And, as stated here and elsewhere, they believe
that Old Testament lifespans were vastly longer - this would push humans
back even further...

> 4.18 Haldane's Dilemma proves that humans could not have evolved over the
> time span evolutionists say they did.

* Here they go again, "proving" that evolution couldn't occur... what is
"Haldane's Dilemma" anyway?


> Section 5: Paleontology, Fossils, Transitional Forms

> 5.1: The feather impressions in fossils of Archaeopteryx are forgeries.

* Really, then why are they calling it a bird in the next statement (5.2)?
Do they have any evidence to back up this extraordinary claim? What about
the newer fossil forms showing apparent intermediaries between reptiles and
birds - all forgeries too??

> 5.2: Archaeopteryx is not a transitional form but a full-fledged bird. Any
> reptilian characteristics it displays are mirrored in modern birds such as
> the hoatzin.

* Directly contradicts 5.1!

> 5.3: Protoavis precedes Archaeopteryx in the fossil record, so
Archaeopteryx
> cannot possibly be a transitional form.

*?

> 5.4: The Cambrian explosion is a sure sign of the activity of the Creator,
> suddenly creating a multitude of complex forms out of nothing. There are
no
> fossils before the explosion.

* Wrong. Again a "sure sign." Their unwillingness to entertain any
alternative explanations is unacceptable.

> 5.5: All of the explanations of gaps in the fossil record, such as the
> invocation of punctuated equilibrium and the low probability of
> fossilization, render the evolutionary prediction of transitional forms
> unfalsifiable.

Damn, I'm getting tired of this! I'm gonna pick a few more then stop....

> 5.7: In their search for transitional forms, the evolutionary community
has
> been taken in by outright fraud, as in the case of Piltdown Man, which was
> accepted as a valid specimen for 40 years, and by unfounded speculation,
as
> in the construction of Nebraska Man from what later turned out to be a pig
> tooth. This shows how unobjective evolutionists are.

* So it's surprising that they were fooled by someone deliberately trying to
mislead them? What are they trying to imply here - that all the other
evidence is also bogus? They should point out that creationists are just as
likely to make mistakes - there's the classic case of the "Paluxy Man
Tracks" case where Morris and his crew claimed to have found fossilized
human footprints mixed in with dinosaur footprints. Examination by
scientists determined that they were all dinosaurian - none were human. This
is even worse than the Plitdown case as no-one was trying to purposely
deceive the creationists they deceived themselves!

> 6.1: It is likely that many structures in the universe were created with
the
> mere appearance of old age.

* "Likely?" based on what? isn't it more likely that they /are/ aged?!

> 6.2: Evolution teaches that there are no such things as souls, that the
> Bible is fraudulent, and that God does not exist.

* Evolution teaches no such thing!

> 6.3: Great scientists such as Newton and Kepler believed in a literal
> Genesis.

* Just as many great scientists believe in evolution - so what?

> 6.4: Evolutionists are trying to take over the school system and force
their
> beliefs upon the students.

* No, we are just trying to keep science education limited to matters of
science not mythology.

> 6.5: Natural processes cannot be the cause of qualities seen in humans
like
> love. For instance, the cause of love must be something loving.

* As wonderful as it is and as good as it feels there's no reason to think
this is nothing more than a result of biochemical reactions in the brain.
Certain psychoactive drugs induce the same state and this is clearly a
purely physical cause...

> 6.6: There are many theories of evolution, each of which "conclusively
> disproves" the other.

* This is ridiculous.

> 6.8: Electrons are materially inconceivable, but physicists largely accept
> them as real entities. So what is to keep one from accepting the reality
of
> an inconceivable Creator?

* We can /test/ for the presence of electrons. They are ammenable to
scientific analyses. A supernatural creator is not. There is no scientific
evidence for its presence.

> 6.9: The exclusive teaching of evolution in the science classroom violates
> the teaching of multiculturalism, because many different cultures have
> creation myths which contradict evolution.

* Again, evolution is taught in science class because it is /science/ - it
is not mythology class.

> 6.11: Nothing can be proven, particularly events in the past. Therefore,
> creationism must be just as reasonable as evolution.

* No, nothing can be absolutley proven but theories can be supported by
evidence.

> 6.12: There is nothing wrong with invoking supernatural explanations.

* No, it just isn't scientific. How are we supposed to choose between the
various (unsupportable) supernatural explanations??

> 6.13: There are many unanswered questions in science, such as the details
of
> the origin of the universe and of prebiotic synthesis. Thus we require a
> supernatural God for explanation.

* Another ridiculous argument - just because we don't have all the answers
or are unlikely to answer some questions does not mean we "require a
supernatural God for explanation!



PHEW!

[tracer]

Speakin' of strawman arguments against evolution, have you seen the Chick Tract called "Big Daddy"?

It's at http://www.chick.com/reading/tracts/0055/0055_01.asp, and is quite a riot.

[DrFidelius]

I'm still waiting for HideoHo to come back with his quotes from Behe that undermine "Darwinism". Regardless of the fact that Behe does not question that descent with modification through the mechanism of natural selection is probably the dominant fact of the history of life on Earth.

Heck, I'm still waiting for College Student to post how archaeology supports a literal interpretation of the Bible and disproves "Darwinism".

(For that matter, I am still waiting for someone whom I shall not name to post at least the title of the book he found in that New Age bookstore near Stonehenge that disproves "Darwinism". Do I see a pattern here?)

[Satan]

Originally posted by DrFidelius

For that matter, I am still waiting for someone whom I shall not name to post at least the title of the book he found in that New Age bookstore near Stonehenge that disproves "Darwinism".

Okay, this amused the hell out of me!

I think that I, in a lampoon of he-who-cannot-be-named, made reference to a book purchased in a New Age bookstore near Stonehenge. I don't think that he-who-cannot-be-named actually made that reference.

So, I'm laughing over here, but also I am proud that my lampoon was so dead-on, someone I hold in such high esteem thought it was real! :D
__________________
Yer pal,
Satan - Commissioner, The Teeming Minions (http://football.fantasysports.yahoo.com/full/show?lid=39428&page=leaguehome)

TIME ELAPSED SINCE I QUIT SMOKING:
Five months, three weeks, three days, 13 minutes and 38 seconds.
7080 cigarettes not smoked, saving $885.05.
Extra time with Drain Bead: 3 weeks, 3 days, 14 hours, 0 minutes.

"I'm a big Genesis fan."-David B. (Amen, brother!)

[JDeMobray]

Originally posted by Satan
Okay, this amused the hell out of me!

I think that I, in a lampoon of he-who-cannot-be-named, made reference to a book purchased in a New Age bookstore near Stonehenge. I don't think that he-who-cannot-be-named actually made that reference.

So, I'm laughing over here, but also I am proud that my lampoon was so dead-on, someone I hold in such high esteem thought it was real! :D

Since I'm primarily a lurker on these boards, but one who loves this particular topic of debate (I'm multi-lurking over on The Pizza Parlor even as we speak.) is there any way to let me in on this joke? He-Who-Cannot-Be-Named?

[David B]

We could tell you, but then we'd have to kill you.

For you see, like the demons of old, we fear that if we name him, he may show up again.

(Hey, it happened on LBMB2 -- they mentioned Daniel Schwarr and he appeared!)

[Gaudere]

I think He-Who-Cannot-Be-Named did in fact mention the book from the New Age section near Stonehenge, though, although since the thread is gone it can't be proven either way. But I'm pretty sure in his first few posts he mentioned the book he found there that would disprove evolution.

[domina]

Are you talking about that 21-year-old Christian fanatic who used to keep witnessing here? (I've forgotten his handle, so I couldn't name him anyway.)

[David B]

Oh, no, he was much older than 21 (at least, that was his claim). His name began with a "P."

[Palm Cove]

As a clue to the identity of P, is he the banned person in the "what if" thread that someone just re-opened?

[Triskadecamus]

I am a little busy right now, preparing a new novel, and filling out patent applications for my new inventions, but next week, when I have time to write a more extensive post on the subject, I will reveal to everyone just who the mysterious poster who cannot be named really was. (note: I shall show not only the board name, but the true identity of the PWCBN, and give a brief proof of those facts I have been able to obtain from certain government files made available to me.) For now, it will have to suffice that the PWCBN is greatly feared here, mostly because his clear logical thinking, and forthright ideals were a threat to the closed minds which congregate here.

When I do post these missives, which will have to be done in several parts, owing to the need for thorough exposition, I will include several references showing his complete debunking of “Evolutionism” and the cabal of science involved in supporting this bankrupt philosophy.

I have to go now, my laboratory work is at a critical stage.

Tris.

[PeeQueue]

HA!

LOL!

PeeQueue

[manhattan]

Originally posted by Gaudere
I think He-Who-Cannot-Be-Named did in fact mention the book from the New Age section near Stonehenge, though, although since the thread is gone it can't be proven either way. But I'm pretty sure in his first few posts he mentioned the book he found there that would disprove evolution.

You "skeptics" and "scientists" are all alike! Surely, if PWCBN had said such a thing, some "evidence" would exist in the thread fossil record. But when the "evidence" fails to turn up, you simply choose to "believe" what your "memory" tells you.

Proof that you are just a religious as anybody.

[lissener]

He Who Cannot Be Named is before my time, but in my backwards browsing I've come across some very singular posts by a certain person--he, as ever, doesn't really use sense--whom I imagine to be the one referred to.

N'est-ce pas?

[Freyr]

lissener wrote:

He Who Cannot Be Named is before my time, but in my backwards browsing I've come across some very singular posts by a certain person--he, as ever, doesn't really use sense--whom I imagine to be the one referred to.

Robert Persig? Didn't he write a couple great/crazy books!

[glee]

Well I remember a very long thread which started with a man, a book and a refutation of Darwin.

Unfortunately I have (genuinely) forgotten his name.

But you chaps can see when I joined SDMB, so there's a limit how far back you have to look.

Does anyone remember Guy Stuff?
That was much more enjoyable! :D

[andros]

Satan, he did indeed begin with a book purchased at Stonehenge.

I know this for a fact.

I just found the entire thread, archived on my hard drive.

No, I will not post any of it.

Ever.

My eyes have melted.

[Spiritus Mundi]

The chances of the spontanious life occurance was calculated as 1/ largest number ever

Given that the purpose of this board is to fight ignorance, and understanding that others have the subjects of natural selection, evolution, and biochemistry covered quite nicely, I will address mathematics.

Put 'em up.

1) To calculate a probability it is necessary to either be in control of or to be able to accurately describe the field of all possible outcomes. Neither is the case with abiogenesis.
(ex: what are the odds that I will have chicken for dinner tonight? Is it accurate to simply add up the number of different foods in my refrigerator and place that number over 1?)

2) To calculate a probability for any natural abiogenesis to occur it is neccessary to fully enumerate all possible paths to life. This is beyond our capacity at present, and will quite possibly always be beyond our capacity.
(ex: I say hello to you in your living room. You point immediately to your front door, which has 17,458,321,677,976,324,787,688,354,546 deadbolts in place and conclude that I could not have walked in. I ask if you have a back door.)

3) There is no "largest number ever". There never will be. If you like books I suggest searching any decent source on the words "Cantor" and "infinite".
(ex: Oh yeah! Well I have infinity plus one reasons why life could never have evolved!)

[Spiritus Mundi]

Oooops.

I've been away too long, my reflexes are off. I got to the end of page 1 and hit "reply". Please excuse the non-sequitor.

[Triskadecamus]

Originally posted by Spiritus Mundi
Please excuse the non-sequitor. None of us have been sequiting for a while, anyway.

Tris