# Are the English originally from Continental Europe? **URL:** \ **Category:** Factual Questions\ **Created:** [February 12, 2013, 8:53pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117 "2013-02-12T20:53:41Z")\ **Posts on this page:** 20\ **Page:** 3
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 15, 2013, 4:32pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/41 "2013-02-15T16:32:34Z")
> [@blindboyard](#): > > Camlann is, though. Camlann would be another example of a name incorporating the _cam-_ “army” element; I would expect the second element is related to modern Welsh _llan_ “church” also found in older place-names meaning “village”, original meaning perhaps “building”? > [@blindboyard](#): > > **Bobx** , no mention of Cerdic? Cerdic is another example, like Vortigern (containing the same element _dig/tig_ “chief” as in the Irish name Tighe) and Rigothamus, of a title that has come to be miscontrued as a personal name. There were two kinds of local rulers in post-Roman Britain: the _ceredig_ “landlord” and the _guletig_ “warlord”. A prominent example of a Guletig is Cunneda (“Kenneth”) who had served with Roman troops straddling Hadrian’s wall until he was invited, shortly after the 410 collapse of Roman authority, to north Wales to rule the area and command its defenses against Irish raiders; his descendants were the princes of Gwynedd (Welsh repronunciation of the “Kenneth” name); he is one of the more “solid” figures of this period (that is, little that looks like legendary embellishment in the account). But south Wales did not become organized as “the principality of Powys” for quite some time (Powys never did become as coherent a state as Gwynedd), being ruled at first by a patchwork of “landlords”, major property-owners loosely linked by marital alliances etc. so that a large stretch of what became Powys is still called the Ceredigion (source of the English word “cardigan”). Once Cerdic became used as a name, it was often metathesized to “Cedric” because many Germanic names had _-ric_ as second element, but it is not Germanic in origin. > [@Floater](#): > > What islands? I can’t find any on my map. Are you sure you are looking at a map of Denmark??? The most prominent islands between Jutland and Sweden are named Fyn (major city Odense), Lolland, and Zealand (major city Copenhagen). > [@Floater](#): > > “Helsing” as in Helsingborg/Helsingør (Elsinore), [Hälsingland](http://en.wikipedia.org/wiki/H%C3%A4lsingland) and Helsingfors (Helsinki) is a descriptive term and means a place where the water gets narrow. If the people in Helsingborg were called _helsingar_ it’s because they lived there, not the other way round. I do not find any root _hels_ or _häls_ for “strait”; are you sure? The suffix _-ing_ denotes a clan/tribe; it is possible that the founder of the clan was named “Hels-something” because he took control of some base at a “strait” but I need to find some other examples of such a root being used for “where water gets narrow”. I do find that _Helsingfors_ “Helsinki” in Finland is not ancient but founded during the Swedish conquest of Finland, named for Hälsingfors in Hälsingland (halfway up the Gulf of Bothnia) where the usage of variants of “Helsing” as a family name remains common; in the oldest references it seems clear that “Helsing” is the name of the people and “Helsingland” is so called because that’s where they live, not the reverse as you are saying. ---
**Author:** ![Shakester](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/shakester/32/437_2.png) [@Shakester](https://boards.straightdope.com/u/Shakester)\ **Post date:** [February 15, 2013, 4:41pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/42 "2013-02-15T16:41:24Z")
At least [one English person](http://articles.sun-sentinel.com/1997-03-09/news/9703080239_1_adrian-targett-cheddar-man-dna-samples) can prove his family have been in England for a _very_ long time. ---
**Author:** ![Dr.Drake](https://avatars.discourse-cdn.com/v4/letter/d/ad7895/32.png) [@Dr.Drake](https://boards.straightdope.com/u/Dr.Drake)\ **Post date:** [February 15, 2013, 4:57pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/43 "2013-02-15T16:57:35Z")
> [@Bob\_X](#): > > Camlann would be another example of a name incorporating the _cam-_ “army” element; I would expect the second element is related to modern Welsh _llan_ “church” also found in older place-names meaning “village”, original meaning perhaps “building”? I don’t know where you got the idea that _cam-_ means “army.” In the word _Camlann_, it is undoubtedly _cam-_ “crooked, curving” + _glan_ “bank”, the same name (though not necessarily the same place) as the attested Roman-era _Camboglanna_. > [@Bob\_X](#): > > Cerdic is another example, like Vortigern (containing the same element _dig/tig_ “chief” as in the Irish name Tighe) and Rigothamus, of a title that has come to be miscontrued as a personal name. There were two kinds of local rulers in post-Roman Britain: the _ceredig_ “landlord” and the _guletig_ “warlord”. A prominent example of a Guletig is Cunneda (“Kenneth”) who had served with Roman troops straddling Hadrian’s wall until he was invited, shortly after the 410 collapse of Roman authority, to north Wales to rule the area and command its defenses against Irish raiders; his descendants were the princes of Gwynedd (Welsh repronunciation of the “Kenneth” name); he is one of the more “solid” figures of this period (that is, little that looks like legendary embellishment in the account). But south Wales did not become organized as “the principality of Powys” for quite some time (Powys never did become as coherent a state as Gwynedd), being ruled at first by a patchwork of “landlords”, major property-owners loosely linked by marital alliances etc. so that a large stretch of what became Powys is still called the Ceredigion (source of the English word “cardigan”). > > Once Cerdic became used as a name, it was often metathesized to “Cedric” because many Germanic names had _-ric_ as second element, but it is not Germanic in origin. What? I know this is another case of ["Oh no! Someone is wrong on the internet!](http://xkcd.com/386/), but in the interest of fighting ignorance: _tig-_ does not mean “chief”. The element _tigern-_ in Vortigern does, but the -ern is important; otherwise, you have a root meaning “house, household.” I don’t know where you’re getting the Irish name Tighe, but it doesn’t mean “chief.” I don’t know where you get the idea that Ceretic is a title rather than a quite common given name, as indeed it remains to this day. \*Guletic \*(modern _gwledig_) is from the word _gwlad_ “country” plus the adjectival suffic _-ic_. You can’t just look at the letters “tic” and assume that they are part of one morpheme. I don’t know where you get your information as to how these titles actually worked in Dark Age Britain. Gwynedd has nothing to do with Kenneth. Kenneth is a name from Old Irish, not Brythonic; the first element is _cenn_ (modern _ceann_, Welsh _penn_). You are right about cardigan and the Cerdic \> Cedric change. ---
**Author:** ![Floater](https://avatars.discourse-cdn.com/v4/letter/f/dc4da7/32.png) [@Floater](https://boards.straightdope.com/u/Floater)\ **Post date:** [February 15, 2013, 5:10pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/44 "2013-02-15T17:10:42Z")
> [@Bob\_X](#): > > Are you sure you are looking at a map of Denmark??? The most prominent islands between Jutland and Sweden are named Fyn (major city Odense), Lolland, and Zealand (major city Copenhagen). I misread you, but on the other hand that part of Sweden was Danish at that time. > [@Bob\_X](#): > > I do find that _Helsingfors_ “Helsinki” in Finland is not ancient but founded during the Swedish conquest of Finland, named for Hälsingfors in Hälsingland (halfway up the Gulf of Bothnia) [ol] [li]There has never been any such thing as a “Swedish conquest of Finland”.[/li][li]Helsinki is a fennification of Helsingfors in Swedish, one of the two official languages in Finland.[/li][li]There is no such place as Hälsingfors in Hälsingland.[/li][li]Hälsingland is situated at the coast of the Bothnian sea.[/li][/ol] > [@Bob\_X](#): > > where the usage of variants of “Helsing” as a family name remains common; in the oldest references it seems clear that “Helsing” is the name of the people and “Helsingland” is so called because that’s where they live, not the reverse as you are saying. Helsing is not a particularly common name. Hälsing does indeed mean a person from Hälsingland and the region is named after the people, but the people got its name after their location and it’s not a “tribal” name like Danes, Saxons and others. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 16, 2013, 8:37am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/45 "2013-02-16T08:37:44Z")
> [@Dr.Drake](#): > > I don’t know where you got the idea that _cam-_ means “army.” In the word _Camlann_, it is undoubtedly _cam-_ “crooked, curving” + _glan_ “bank”, the same name (though not necessarily the same place) as the attested Roman-era _Camboglanna_. As you can see, Welsh is not a language I know much about; I didn’t think I could write about the Anglo-Saxon stuff and not mention the Britons but maybe I should just have left that whole side of the story out. I’m not sure, now that you prod me, from where it got into my head that there was a _cam-_ root for “army”; perhaps one of my sources said that as a speculation for the source of that Camulo “Mars, sort of” deity that I didn’t know. The best I can find in a Welsh dictionary is that aside from the “crooked, amiss etc.” root there is a usage of _cam_ for “step; stride”; does Camulo perhaps mean the “marcher”? > [@Dr.Drake](#): > > What? I know this is another case of ["Oh no! Someone is wrong on the internet!](http://xkcd.com/386/), but in the interest of fighting ignorance: > > _tig-_ does not mean “chief”. The element _tigern-_ in Vortigern does, but the -ern is important; otherwise, you have a root meaning “house, household.” I don’t know where you’re getting the Irish name Tighe, but it doesn’t mean “chief.” I did just take it for granted that all the tig’s were connected. I have looked up “Tighe” and the classic Gaelic spelling for it was “Tadhg” which is a whole other kettle of fish. > [@Dr.Drake](#): > > I don’t know where you get the idea that Ceretic is a title rather than a quite common given name, as indeed it remains to this day. It seems to have been a title first, though, which is not all that unusual. St. Patrick writes to the ruler of Strathclyde as “Coroticus” which is commonly taken to be his personal name-- but I would think rather that someone of lower rank did not address the ruler by his personal name in those times and that Coroticus was the locally appropriate form for “Your Majesty”. Compare Sidonius addressing the high king of Britain as Rigothamus (and Roman chroniclers only know him as Riothamus) which is certainly not the personal name (whether or not the personal name was “Arthur”); Vortigern’s personal name is likewise lost. > [@Dr.Drake](#): > > \*Guletic \*(modern _gwledig_) is from the word _gwlad_ “country” plus the adjectival suffic _-ic_. You can’t just look at the letters “tic” and assume that they are part of one morpheme. OK, thanks. For the etymology of _ceredig_ would _ceraint_ “kinfolk” look like a plausible root (assuming _-aint_ is some kind of suffix)? > [@Dr.Drake](#): > > I don’t know where you get your information as to how these titles actually worked in Dark Age Britain. That’s the thing, there isn’t any information about “how” these titles worked; as with most issues in the Dark Ages, you have to fill in large blanks as best you can. Near as I can tell, the difference between the _guletic_ and _ceredig_ titles is that the former was acquired by military merit and the latter by inherited property and connections, but this is based on very little: the story of the “invitation” to Cunneda to come rule north Wales may be a polite fiction for a violent takeover, or reflect a genuine desperation at the time for a good commander; in either case I am taking this to be an indication of what a “guletic” was like, but maybe that is just Cunneda’s story and not a general principle. > [@Dr.Drake](#): > > Gwynedd has nothing to do with Kenneth. Kenneth is a name from Old Irish, not Brythonic; the first element is _cenn_ (modern _ceann_, Welsh _penn_). Everyone agrees Gwynedd is derived from Cunneda, the first element assimilated to _gwyn_ “white”. I assume he spoke a Q-Celtic, and thus the Welsh did not recognize that the first element was really _pen/cen_ “head”. > [@Dr.Drake](#): > > You are right about cardigan and the Cerdic \> Cedric change. Nennius says Ceredigion was named for Ceredig, son of Cunneda by the daughter of Coel Hen, the first ruler of post-Roman Britain. I assume there really was an “old king Cole” but once we recite the ditty about how he was a merry old soul we have pretty much exhausted our knowledge, and the ditty itself seems based on a slight misunderstanding: the usage of _hen_ “old” here should probably be rendered “Coel the First” meaning that he is called Coel Hen not because he was aged but to distinguish him from later members of noble families that liked the name (Arthur became a popular name too, and several stories about Arthur are likely to refer to much later figures than the _rig-utham_ of the 5th century). Did Cunneda actually marry a daughter of Coel, or did the rulers of the Ceredigion simply decide that they ought to have an eponymous ancestor linked to two famous names of kings from antiquity? I would think the latter more likely, and that again “Ceredig” was not at first a personal name but the royal style of the early rulers there. > [@Floater](#): > > I misread you, but on the other hand that part of Sweden was Danish at that time. That’s exactly what I meant: back when the Jutes were on Jutland, no Danes were on Jutland; the Danes were in what is now a piece of western Sweden (Skane and Halland provinces) and the intermediate islands. [quote=“Floater, post:44, topic:650117”] [li]There has never been any such thing as a “Swedish conquest of Finland”.[/li][/quote] Sweden conquered it in the 13th century and retained it through the end of the 19th. [quote=“Floater, post:44, topic:650117”] [li]Helsinki is a fennification of Helsingfors in Swedish, one of the two official languages in Finland.[/li][/quote] Yes. [quote=“Floater, post:44, topic:650117”] [li]There is no such place as Hälsingfors in Hälsingland.[/li][/quote] My bad. I misread the history. Helsingfors in Finland was named for the “rapids” of the Helsingea river, which was named for a stream in Hälsingland but there was no “helsing rapids” back in Sweden. > [@Floater](#): > > [li]Hälsingland is situated at the coast of the Bothnian sea.[/li] As I said. > [@Floater](#): > > Helsing is not a particularly common name. Probably most of that name are not descended from the original ruling family but represent people who had move from that area to somewhere else and were known by where they came from (like, “English” is a family name in Ireland; “French” is a family name in England); similarly, I would not expect that modern Turings can trace themselves to the Wodenite Turings, but rather to somebody who moved to a different part of Germany from Thuringia and therefore got called by his new neighbors “Turing” meaning “the Thuringian guy”; however, the original kingdom of _Thüringen_ was indeed named so after a ruling family. > [@Floater](#): > > Hälsing does indeed mean a person from Hälsingland and the region is named after the people, but the people got its name after their location and it’s not a “tribal” name like Danes, Saxons and others. You are contradicting yourself unless I am misunderstanding you. Yes, the region is named after the people (or more precisely, after the leading family of the original settlers there); no, it’s not the other way around. ---
**Author:** ![Johanna](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/johanna/32/8318_2.png) [@Johanna](https://boards.straightdope.com/u/Johanna)\ **Post date:** [February 16, 2013, 8:54pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/46 "2013-02-16T20:54:14Z")
> [@Bob\_X](#): > > There really isn’t such a thing as “Q-Italic”. Sure there is! Latin and Faliscan, plus the whole breed of Romance that came from Latin, are Q-Italic. > [@](#): > > What happened to the number four is unique to the numerals; other instances of \*p from Proto-Indo-European remain “p” such as _pater_ etc. It seems you have mistaken my meaning. I was never saying that in Latin [p]\>[kw]. I clarified that in post 26 above: In P-Celtic and in P-Italic, PIE \*[kw]\>[p] as a rule, where \*[kw]\>[k] in Q-Celtic and remains [kw] in Q-Italic. It’s called Q-Italic because it retained PIE \*[kw-] as “qu-.” I never meant to imply a general shift of [p]\>[k(w)]. It’s just that this happened through assimilation in the special case that I used for illustration, the numbers 4 and 5, perhaps because of their habitually being pronounced one after another in counting, as **septimus** suggested above in post 25. The retention of inherited \*[kw-] in Q-Celtic and Q-Italic seems to have further locally assimilated neighboring \*[p-] in this one special instance, without any wider assimilation effect. Hope that clears up any misunderstanding. My actual point in post 21 was that the P-Q split cuts right across both Celtic and Italic, which has been suggested as evidence for their having shared a subgroup of IE called Italo-Celtic that separated into Italic and Celtic sometime later after the shared \*[kw-]\>[p-] shift. Which would mean that Celtic’s closest relative is Italic. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 17, 2013, 5:47am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/47 "2013-02-17T05:47:41Z")
> [@Johanna](#): > > Sure there is! Latin and Faliscan, plus the whole breed of Romance that came from Latin, are Q-Italic.It seems you have mistaken my meaning. I was never saying that in Latin [p]\>[kw]. I clarified that in post 26 above: In P-Celtic and in P-Italic, PIE \*[kw]\>[p] as a rule As a rule??? You have only cited \*\*kwetwor, _penkwe_ assimilating to both p’s in Oscan-- and as I said what happened to four/five is unique to those numerals; in general numerals are subject to odd funny shifts, compare Mycenaean Greek (written in Linear B) _qe.to.ra, pe.qa._ becoming _tetra, penta_ in Greek but that is not part of any general kw-\>t shift. > [@Johanna](#): > > It’s called Q-Italic because it retained PIE \*[kw-] as “qu-.” I never meant to imply a general shift of [p]\>[k(w)]. But you seem to be implying that there is some general shift of kw-\>p in the P-Italic? If that is what you are claiming, you need to cite anything else but “four/five” because we know that funny things happen to those words. > [@Johanna](#): > > a subgroup of IE called Italo-Celtic that separated into Italic and Celtic sometime later after the shared \*[kw-]\>[p-] shift. Which would mean that Celtic’s closest relative is Italic. Celtic and Italic are known to be the closest relatives (the combined subgroup is usually called Centum) for a variety of better reasons, but the kw-\>p shift in P-Celtic is well after Italic had gone its own way. ---
**Author:** ![Dr.Drake](https://avatars.discourse-cdn.com/v4/letter/d/ad7895/32.png) [@Dr.Drake](https://boards.straightdope.com/u/Dr.Drake)\ **Post date:** [February 17, 2013, 4:49pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/48 "2013-02-17T16:49:28Z")
> [@Bob\_X](#): > > But you seem to be implying that there is some general shift of kw-\>p in the P-Italic? If that is what you are claiming, you need to cite anything else but “four/five” because we know that funny things happen to those words. Carl Darling Buck’s _Grammar of Oscan and Umbrian_, §150: “k[sup]w[/sup], Lat. _q_, appears as _p_. Examples: O. **pud** , _pod_, U. **puř-e** : L. _quod_; O. **píd** , U. **piř-e** : L. _quid_.” As for the earlier response to me, “Kenneth” may be an anglicization of Cunedda, though not one I’ve encountered (the two are similar in pronunciation). However, “Cunedda” is not the source of the name “Kenneth,” and neither are the source of the name “Gwynedd.” _Gwynedd_ comes from a root \*\*wen-_; cun- is the dog-word, PIE \*ḱwṓ, and Kenneth is from the Celtic head word, \*\*kwenn-_. ---
**Author:** ![Polycarp](https://avatars.discourse-cdn.com/v4/letter/p/82dd89/32.png) [@Polycarp](https://boards.straightdope.com/u/Polycarp)\ **Post date:** [February 17, 2013, 11:35pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/49 "2013-02-17T23:35:00Z")
Although I absolutely love the involved discussion into lE linguistic taxonomy which has been the subject of most posts in this thread, may I observe that the OP asks, not whether the English language derived from continental Europe, but whether the English people did. And, just as you have 2[sup]n+3[/sup] great[sup]n[/sup]-grandparents, who may end up coming from a multiplicity of ethnic origins, a modern ethnic group may derive from a wide range of ancient and medieval sources. England was inhabited by people before the Celts arrived. They ate apples and climbed hills. And that is literally all we know about them, other than what might be inferred from the occasional burial. Did any of them survive and intermarry with the invaders? Probably so – but their linguistic and cultural customs are so thoroughly subsumed under their successors’ that only what I noted above is known with any real amount of certainty. Still prior to any history for the area, probably the first group we can still identify were the Goiledic Celts. Almost no record of their time as the dominant people of what is now England remains – but a little does. By and large they were driven out, to Ireland and fringe areas like the Highlands and offshore islands, by the Brythonic Celts, who are the dominant people over most of Britain as history dawns on the island. Did any of the Goiledic people remain? Probably. How many? We have no idea – but their language and culture were almost totally subsumed by their Brythonic overlords. The people remained mostly Brythonic Celts – _Britons_ – when the Roman Empire invaded and incorporated most of England within itself. But they were influenced by the Latin language, which functioned as the tongue of government and as lingua franca, and by the culture of the Roman legions and settlers. This however was not merely Romans but a cosmopolitan mix of the other peoples of the Empire: Greeks, Illyrians, Iberians, Semites, Anatolian and North African peoples we no longer speak of with familiarity beyond experts in history and historo-cultural anthropology… As Roman rule declined and the legions were withdrawn to support one or another Enoerir-wannabe’s claims, the island became a tempting refuge for some Germanic groups that were feeling pressure from other, larger and/or more aggressive peoples. These peoples: the Jutes, the Angels, and the lowland Saxons, took possession of, first, the eastern and southern coasts, and then the interior of Midland England. The Briton leaders and fighters largely drew back to Cornwall, Wales, and the Northwest, where Strathcllyde and Rheged remained Briton kingdoms. But what of the rank and file Briton peoples? Many of course fled to the surviving Briton realms, but a fair percentage of them remained as a subjugated minority, gradually assimilated to the Angles and Saxons but contributing cultural traits and vocabulary to the nascent English culture. After a couple of centuries, Danish and Norse influence, first from Viking raids and then from colonists, had a rather significant influence on Anglo-Saxon culture and language. Modal verbs, number words, pronouns, and other ‘basic’ vocabulary, and seveeral culture traits, were assimilated from them, particularly in East Anglia and Northumbria. Then a small admixture of Normans and people from Aquitaine/Gascony were added to the mix in the aftermath of 1066 and the Angevin Plantagenet monarchy that followed. That mix comprised the English prior to Tudor times. But ever since then, the British Empire has resulted in people from a wide range of peoples and cultures being added to the “English” melting pot. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 18, 2013, 12:16am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/50 "2013-02-18T00:16:21Z")
> [@Dr.Drake](#): > > Carl Darling Buck’s _Grammar of Oscan and Umbrian_, §150: “k[sup]w[/sup], Lat. _q_, appears as _p_. Examples: O. **pud** , _pod_, U. **puř-e** : L. _quod_; O. **píd** , U. **piř-e** : L. _quid_.” OK, there we go. That is what Johanna was wanting to say. Indeed, if that’s what Oscan looks like, then the P/Q division predates the Celtic/Italic division. > [@Dr.Drake](#): > > As for the earlier response to me, “Kenneth” may be an anglicization of Cunedda, though not one I’ve encountered (the two are similar in pronunciation). No, I was assuming that Cunedda was the analogue of Kenneth in whatever version of Q-Celtic was spoken in the Caledonia of his day, which would not yet have been Gaelic (the settling of Dalriada, later the nucleus of the kingdom of Scotland, from Ulster was not until a century and a half later). > [@Dr.Drake](#): > > However, “Cunedda” is not the source of the name “Kenneth,” and neither are the source of the name “Gwynedd.” _Gwynedd_ comes from a root \*\*wen-\*; _cun-_ is the dog-word, PIE \*_ḱwṓ_ This is an example of folk etymology. No, I do not believe the guy’s name was really Dogman. Rather, the vowel in the first syllable of his name was some diphthonged or umlauted thing that the Welsh did not recognize (the important point in the story is that he was NOT FROM WALES, from way up past Hadrian’s wall out near where the Antonine pseudo-wall runs into Pictavia), so when they write down his name they change that first syllable to the nearest Welsh word, however inappropriate, and when his name becomes the name of the country, the first syllable is replaced with something nicer-sounding: wouldn’t you rather live in “white country” than in “dog country”? > [@Dr.Drake](#): > > Kenneth is from the Celtic head word, \*\*kwenn-\*. Which in Irish ended up being pronounced just “ken” but in whatever-dialect-they-spoke-in-the-northern-boonies-in-the-5th-century was pronounced _kuin_ or _kün_ or however. ---
**Author:** ![septimus](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/septimus/32/410_2.png) [@septimus](https://boards.straightdope.com/u/septimus)\ **Post date:** [February 18, 2013, 12:43am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/51 "2013-02-18T00:43:45Z")
> [@Polycarp](#): > > England … Still prior to any history for the area, probably the first group we can still identify were the Goiledic [Goidelic?] Celts. Almost no record of their time as the dominant people of what is now England remains – but a little does. Cite? I’ve not read of evidence for Goidelic on the Island of Great Britain prior to Brythonic. Does the 500 BC Goidelic-Brythonic split in the chart by Ringe et al seem reasonable, or is an earlier split more likely? Perhaps a strict family-tree model for Celtic is inappropriate and instead, like in Germanic or Romance, a geographic interaction model is better, so that Goidelic developed from contact with two neighbors: Q-Celtiberian and Brythonic, and Brythonic from two neighbors: Goidelic and P-Gaulish. According to the cited chart by Ringe et al, Celtic split from PIE 3200 BC, and from Celto-Italic 2600 BC. Where was it for almost 2000 years waiting to enter the “historic record”? Occam’s Razor suggests its expansion was associated with the expansion of the Bell Beaker cultures (or perhaps the Bronze Age cultures which followed Beaker by about 11 centuries). Another expansion that may have occurred in about the same time and place as Celtic and Beaker is the R1b-L11 Y-chromosome now ubiquitous throughout Western Europe. _The fact that this haplogroup suddenly “conquered” Western Europe so thoroughly suggests an identity with the militaristic Celtic culture._ With rapidly accumulating data, the detailed subclades of R1b-L11 may provide a clue to both migrations to Britain, and to the spread of Celtic culture. Unfortunately there still seems to be some controversy about Y-chromosome date calibrations. The earliest specimen of R1b found was in Kromsdorf, Germany at a site associated with Bell Beaker and dated ca 2550 BC. (My source for that date is [Jean Manco’s excellent site](http://www.buildinghistory.org/distantpast/ancientdna.shtml): the journal paper seems to be behind paywalls.) ---
**Author:** ![pseudotriton\_ruber\_ruber](https://avatars.discourse-cdn.com/v4/letter/p/a9a28c/32.png) [@pseudotriton\_ruber\_ruber](https://boards.straightdope.com/u/pseudotriton_ruber_ruber)\ **Post date:** [February 18, 2013, 1:21am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/52 "2013-02-18T01:21:57Z")
Just to straighten out my confusion: Was Europe (the landmass we would recognize as Europe) ever completely unhabited by humans? Did humans migrate to Europe, then die out there, because of glaciers/Ice Age, and then re-inhabit it? Has anyone dated human migration across various parts of Europe? I.e. Greece, 100,000 BC, then France 50,000 BC, then England 10,000 BC, or is it all a muddle? ---
**Author:** ![John\_Mace](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/john_mace/32/185_2.png) [@John\_Mace](https://boards.straightdope.com/u/John_Mace)\ **Post date:** [February 18, 2013, 1:30am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/53 "2013-02-18T01:30:55Z")
> [@pseudotriton\_ruber\_ruber](#): > > Just to straighten out my confusion: > > Was Europe (the landmass we would recognize as Europe) ever completely unhabited by humans? Did humans migrate to Europe, then die out there, because of glaciers/Ice Age, and then re-inhabit it? Has anyone dated human migration across various parts of Europe? I.e. Greece, 100,000 BC, then France 50,000 BC, then England 10,000 BC, or is it all a muddle? Our species, _H. sapiens_, entered Europe about 40k years ago. They spread over the continent pretty quickly. Fossil bones of modern humans have been found in England dated back at least 30k years ago. Prior to that, Europe was occupied by Neanderthals, and prior to that, the predecessors of the Neanderthals, which some think were _H. antecessor_. At any rate, there have been members of the genus _Homo_ in Europe for hundreds of thousands of years, but modern humans only for aout 40k. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 18, 2013, 4:46am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/54 "2013-02-18T04:46:49Z")
> [@John\_Mace](#): > > Our species, _H. sapiens_, entered Europe about 40k years ago. They spread over the continent pretty quickly. Fossil bones of modern humans have been found in England dated back at least 30k years ago. > > Prior to that, Europe was occupied by Neanderthals, and prior to that, the predecessors of the Neanderthals, which some think were _H. antecessor_. At any rate, there have been members of the genus _Homo_ in Europe for hundreds of thousands of years, but modern humans only for aout 40k. It should also be added that the Cro-Magnons of southern France and northern Spain from that very early human presence do appear to be genetically akin to the Basques, so to answer pseudotriton’s question: no, it does not appear that modern human occupation of the continent has ever been interrupted since the first settlement. ---
**Author:** ![Dr.Drake](https://avatars.discourse-cdn.com/v4/letter/d/ad7895/32.png) [@Dr.Drake](https://boards.straightdope.com/u/Dr.Drake)\ **Post date:** [February 18, 2013, 6:47am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/55 "2013-02-18T06:47:39Z")
> [@Bob\_X](#): > > This is an example of folk etymology. No, I do not believe the guy’s name was really Dogman. Rather, the vowel in the first syllable of his name was some diphthonged or umlauted thing that the Welsh did not recognize (the important point in the story is that he was NOT FROM WALES… Brythonic, the ancestor to Welsh, was spoken in what is now Scotland. A language related to Welsh was spoken in Southern Scotland until the 11th century. Pictish is more distantly related. And lots of people were called Dogman: “dog” was a perfectly cromulent naming element. The Irish name Conan / Welsh Cynan, for instance, or the Irish hero Cú Chulainn, or Maelgwn Gwynedd. [QUOTE=septimus] Does the 500 BC Goidelic-Brythonic split in the chart by Ringe et al seem reasonable, or is an earlier split more likely? Perhaps a strict family-tree model for Celtic is inappropriate and instead, like in Germanic or Romance, a geographic interaction model is better, so that Goidelic developed from contact with two neighbors: Q-Celtiberian and Brythonic, and Brythonic from two neighbors: Goidelic and P-Gaulish. [/QUOTE] Yes, that date seems reasonable. The idea of a different model is also good, as we know there was quite a lot of contact between Gaulish and British speakers, and that right up until Caesar’s day the two would have probably been mutually intelligible. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 18, 2013, 7:09pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/56 "2013-02-18T19:09:06Z")
> [@Dr.Drake](#): > > Brythonic, the ancestor to Welsh, was spoken in what is now Scotland. A language related to Welsh was spoken in Southern Scotland until the 11th century. In south-western Scotland, that is Cumbria and Strathclyde, but that is not where Cunedda was from. And the extension of P-Celtic to Strathclyde may have been rather late: the name of the old capital “Dumbarton” (anglicization of a form for “fortress of the Britons”) probably indicates that it was founded by invaders from the south (the locals wouldn’t have said “of the Britons” if they considered themselves also Britons; the Brythonic name for it was _Alt Clut_ “rock of [the forth of] Clyde”). > [@Dr.Drake](#): > > Pictish is more distantly related. And here we get into the usual problem of sparse evidence. For Pictish and tribes bordering Pictavia, we have only a handful of Ogham inscriptions and a couple name-preservations in Roman chronicles. Hopes that the Ogham preserved a pre-Indo-European language have been dashed; it is largely Celtic, and while there may be a stratum of pre-Indo-European words involved, it could also be that we are just not figuring those words out yet; it is a quite “mutant” form of Celtic, and we cannot tell whether they used “P” or “Q” pronunciations because Ogham of course did not distinguish those. The common element _maqq_ looks much like Gaelic _mac_ “son [of…]” and not like Welsh _ap_. From the Roman: Clodius Albinus (western claimant during the Year of Five Emperors) reannexed the strip between the walls of Hadrian and Antoninus Pius and negotiated a kind of _foederati_ (subsidized ally) status for the next tribe north, controlling the Stirling area, the _Myati_ which looks similar to Irish _Meath_ “middle” (which would make sense, as Stirling was in a central position), a root not preserved in Brythonic (nothing came of this, as Septimius Severus won the Empire, the Myati didn’t get their money and turned hostile, so the Severan attempt to refortify the Antonine wall failed to hold it). And straddling the east end of the Antonine wall (this is where Cunedda came from) were the _Votadini_: when in later centuries northerners took part of Lothian for a while, the Welsh called them _Gododdin_ “rose people” which looks, again, like a classic case of folk etymology, the actual name perhaps starting with some consonant that Brythonic did not use. A possible Indo-European root would be like the one in Latin _vates_ “soothsayer” or _votum_ “vow”, Germanic _Wotan_ (modern German _wüten_ is “to rage” but it is thought to have originally referred more to a shamanic trance) but the Irish reflex is _fath_ (modern meaning just “cause; reason” but originally more like “inspired utterance”). > [@Dr.Drake](#): > > And lots of people were called Dogman: “dog” was a perfectly cromulent naming element. The Irish name Conan / Welsh Cynan, for instance, or the Irish hero Cú Chulainn, or Maelgwn Gwynedd. I am not saying it would be impossible for Cunedda to have been named Dogman, just that I don’t think he actually was. To me the Occam’s Razor explanation for why the kingdom founded by “Cunedda” was called “Gwynedd” is that those two are the same word, folk-etymologically assimilated into Brythonic as “dogman” and “white country” because those sounded like reasonable names for a man and a country; but he came from an alien area with a different speech, which apparently shared more vocabulary with Goidelic than Brythonic, except with more primitive pronunciations. For a common source of Cunedda and Gwynedd, I would expect the first element’s pronunciation to have been more like \*_kwen_ “head” than like \*_kwo(n)_ “dog”, which is why I think his name was originally an analogue of “Kenneth” even though it didn’t sound like it to the Welsh. ---
**Author:** ![John\_Mace](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/john_mace/32/185_2.png) [@John\_Mace](https://boards.straightdope.com/u/John_Mace)\ **Post date:** [February 18, 2013, 8:19pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/57 "2013-02-18T20:19:08Z")
> [@Bob\_X](#): > > It should also be added that the Cro-Magnons of southern France and northern Spain from that very early human presence do appear to be genetically akin to the Basques, so to answer pseudotriton’s question: no, it does not appear that modern human occupation of the continent has ever been interrupted since the first settlement. Is there genetic evidence that backs this up? Not saying I know there isn’t, but I’ve not seen it. Do you have a cite? ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 18, 2013, 11:50pm UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/58 "2013-02-18T23:50:43Z")
> [@John\_Mace](#): > > Is there genetic evidence that backs this up? Not saying I know there isn’t, but I’ve not seen it. Do you have a cite? Yes: [Recent confirmation](http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0002700) Similar results had been found before but had been questioned on the basis that contamination from the DNA of recent human handlers might be the cause, so they used a newly-dug-up skeleton which had never been near any except a tiny handful of present-day humans: "We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003… The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. " ---
**Author:** ![John\_Mace](https://sea3.discourse-cdn.com/straightdope/user_avatar/boards.straightdope.com/john_mace/32/185_2.png) [@John\_Mace](https://boards.straightdope.com/u/John_Mace)\ **Post date:** [February 19, 2013, 2:52am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/59 "2013-02-19T02:52:04Z")
> [@Bob\_X](#): > > Yes: [Recent confirmation](http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0002700) > Similar results had been found before but had been questioned on the basis that contamination from the DNA of recent human handlers might be the cause, so they used a newly-dug-up skeleton which had never been near any except a tiny handful of present-day humans: "We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003… The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. " I searched for the word “Basque” in your cite and got zero hits. Can you quote the part that you think supports the claim that “Cro-Magnons of southern France and northern Spain from that very early human presence do appear to be genetically akin to the Basques”. BTW, the individual who was sequenced in that experiment was from Italy, not France or Spain. ---
**Author:** ![Bob\_X](https://avatars.discourse-cdn.com/v4/letter/b/4491bb/32.png) [@Bob\_X](https://boards.straightdope.com/u/Bob_X)\ **Post date:** [February 19, 2013, 4:57am UTC](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117/60 "2013-02-19T04:57:31Z")
> [@John\_Mace](#): > > I searched for the word “Basque” in your cite and got zero hits. Can you quote the part that you think supports the claim that “Cro-Magnons of southern France and northern Spain from that very early human presence do appear to be genetically akin to the Basques”. > > BTW, the individual who was sequenced in that experiment was from Italy, not France or Spain. What the paper I cited to you was about was confirming that the so-called Paleolithic mtDNA sequence really did come from Cro-Magnon skeletons, and not from contamination by the handlers, as had been thought possible because this sequence is still common in Europe. It does not go into details about which European subgroup it is finding; if you download their Table S-1 you get a big file that looks like this: F.1.1 (MINUS 19BP)…C…ATGAACTGGTGGACATCATGTAT F.1.2 … F.1.3 … F.1.4 … F.1.5 … F.1.6 … F.1.7 … F.1.8 … F.2.1 … F.2.2 … F.2.3 … F.2.4 …G… F.2.5 … F.2.6 …CC… etc. etc. etc. where the dots mean “agreement with the Cambridge Reference Sequence”, letters mean the particular point-substitutions that distinguish one haplogroup from another, except for long blocks of letters to mark the “primers” that were used to grab chunks of DNA for sequencing. The only focus of this paper is to verify that the point-substitutions are incompatible with the haplogroups of any of the seven people who handled the bones. For a discussion of the Paleolithic haplogroups and their concentration among the Basque, here is a paper about the [u8a](http://www.ncbi.nlm.nih.gov/pubmed/16719915) subgroup, not the original Cro-Magnon sequence but a derivation from it (that is, with a new point-substitution) which occurs in scattered locations around Europe only (not in Africa) indicating that it originated after entry to Europe, but still nearly 30,000 years ago (from “molecular clock” divergence times: among those sequences which all share the u8a mutation, many have further point-substitutions, so the date of the last common ancestor can be estimated from the substitution rate in order to give enough time for the observed distribution of subsequent mutations). The side-tabs from the u8a paper give links to other NCBI papers on the subject, if you can stand all the jargon. It is really only in the past decade that this has become solid, so we don’t have any good popularizing summaries of the results. [Previous page](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117.md?page=2) [Next page](https://boards.straightdope.com/t/are-the-english-originally-from-continental-europe/650117.md?page=4)