Or did they evolve concurrently with cellular species? Whats the current theory?
Nothing can evolve unless it reproduces.
Viruses lack the capability to reproduce (or do anything else) on their own. They can only reproduce by hijacking the machinery of a cell. Therefore they could only evolve concurrently.
Current thinking is that viruses are merely fragments of rogue genetic material that were derived from cellular organisms. They are not “alive” since they need to hijack a cell’s metabolic machinery in order to function. Many years ago, they were thought to be primitive precursors to cellular life, but that view has long been abandoned. Present-day viruses are descended from cellular life, not the other way 'round. Cellular life undoubtedly had more primtive ancestors, but they were not viruses.
I don’t know if there is a way to theorize, but like Yeah said, other cells must have existed before viruses, because viruses (unlike true living organisms) need another cell’s machinery to reproduce.
An interesting question along this line is: did life start more than once? I’ve heard that zapping mud with high voltages (or something like that) can produce nearly-biological molecules, which makes you wonder if several different origins aren’t possible.
Of course there’s really no way to test or collect evidence… that I know of.
Anyway, viruses are weird.
All present-day organisms, including viruses, share elements of the same genetic code (which combinations of bases code for which amino acids, for example) and therefore are descended from the same ancestor. It is quite possible that life could have evolved more than once in the early history of the earth, but if so the other lineages have left no trace and it is impossible now to find out.
I learned in college that all living things have basically the same biochemistry and all came from a common ancestor. But in the 9 years since I got out of college a lot of things I learned have turned out not to be true. There are a lot of organisms living in weird environments that can’t be grown in culture and that have strange properties (like huge prokaryotic cells in fish guts that are visible with a magnifying glass, which I was taught was impossible). So I wonder if anyone has ever looked very hard at unculturable organisms living under extreme conditions to try to find one that isn’t like us.
Can you give me a good site to read more about this? I had always assumed that virii (and chromosomes!) were descendants of some nucleic acid/protein complex predating cellular life.
Show me the funding!
So far, nothing has been found that doesn’t code its heritable material the same way. Finding a remnant species of one of the other experiments would be fascinating, but it is hard enough to get the money needed to study pathogens.
If you are willing to pay for it (lots of basic research needed, including new techniques to grow organisms which are “unculturable” ) I am sure I could come up with a lab-full of grad students…
Dr. F, I love the fact that mentioned funding for research, check out the vatgrown meat thread http://boards.straightdope.com/sdmb/showthread.php?threadid=56408 to see an example of something that ain’t going to see any funding in the sense of return for dollar.
One organism that does live under extreme conditions that is widely used in molecular biology: Taq (Thermus aquaticus), the supplier of PCR polymerase (originally).
As to viruses in general, they are molecular parasites of high efficiency, which means they are highly evolved. Many are species specific, this implies that they are not just junk DNA that infects whatever is available.
I?ve never had a class in virology, but these are pretty impressive ‘not organisms’ with respect to reproduce their nucleic acids. They are the pure parasite.
They are theories that having a latent viral infection (read: it doesn’t effect the host /a provirus) confers an advantage when it wipes out a competitor species which doesn?t have resistance that is similar in genome.
Cellular life undoubtedly had more primtive ancestors, but they were not viruses.?
I too would like to see the c/site on this. The replicating nucleic acids with protein coats may not have been ‘viruses’ our modern sense, but auto-replicating/catalytic nucleic acids that are assumed to give rise to cells in association with lipid-type micelles certainly share some basic characteristics.
Before there were cells, could there by viruses? No. Self-replicating nucleic acids, Yes.
And with regard to viruses containing rogue DNA derived from cellular DNA, this is true in the case of oncogenes. Rous (who had to wait a very long time), H. Temin, and P.K. Vogt and H. Varmus, all won Nobel Prizes with research involving the src oncogene. A cancer causing retrovirus that ‘got’ its cancer causing ability from obtaining DNA from its host. .
Sorry, I don’t have time to search through the web for this, but the on-line edition of the Encyclopedia Britannica probably covers it in part in the article on viruses. I note that my copy of the Britannica doesn’t even consider the possibility that viruses are primitive remnants of the early history of life, either in the article on viruses or on the origin of life.
The info can also be found in college-level General Biology texts, such as Keeton and Gould’s Biological Science.
One fact that has to be accounted for is that viruses are extremely diverse in their genetic make-up, but they are not particularly closely related to one another. While all cellular organisms contain both DNA and RNA, viruses contain either RNA or DNA (never both) and this can be either single or double-stranded. The usually have a protein coat, of varying complexity, and a few may contain a few enzymes. IIRC, many are genetically closer to their host organisms than to most other viruses. They all are incapable of reproducing or duplicating their own genetic material without the aid of a host cell’s enzymes and other machinery. Some groups of cellular organisms (bacteria, some plants, arthropods, vertebrates) are prone to viral infections, whereas in others they are almost or completely unknown.
According to my 1980 edition of Keeton and Gould, there are three main hypotheses for the origin of viruses:
-
They are primitive remnants from the early history of life that have managed to persist by becoming parasitic. Arguing against this view is the genetic diversity among viruses, and the difficulty in imagining how they survived before the evolution of cells. In early oceans full of organic chemicals they may have been able to find raw materials suitable for growth, but certainly not the enzymes needed for replication.
-
They are highly specialized parasites descended from cellular forms. Many parasites lose complicated structures found in non-parasitic relatives, and in this view viruses have lost their cytoplasm etc. and only retained their genetic material. Arguing against this view once again is the diversity of viruses and unlikelihood of this process having taken place so repeatedly.
-
They are fragments of genetic material that have somehow become isolated from cells but have retained the ability to control parts of the parent form’s cellular machinery. Some of these fragments have over time evolved complex ways of entering and commandeering cells. One can envision this sort of process taking place in many diverse lineages in cellular life. This is by far the prevalent view in modern biology.
As far as the origin of life, the most popular present theory suggest that the original step was the formation of small membrane-bound “microspheres” (or micelles, as 647 says, sort of like soap bubble) containing rich concentrations of organic molecules. With complex molecules held in close contact within the sphere, metabolic pathways and the genetic machinery for “cell” replication eventually developed. (One alternative scenario suggests organic molecules could adhere to clay minerals, allowing a similar process to occur.) However, it would seem to be necessary for genetic material to evolve in tandem with metabolic and replication enzymes. Something like a cell probably developed first, then the genetic material to replicate it. “Naked” genetic material such as viruses would have no way to retain enzymes etc. in close proximity, so that it is difficult to imagine how they could have evolved first.
The OP is a good question and I hate to sound nitpicky, but it needs one clarification, IMO. The real question posed here is apparently “Did viruses originate separately?” The evolution of viruses has been going on nonstop for the past few billion years. Viruses are still evolving today.
My copy of Fundamental Virology mentions theory #2 and #3 from Colibri’s list. #2 is known as the Regressive Theory, and like Coli said, it doesn’t account for viral diversity very well.
I think #3 is considered to be the most attractive hypothesis right now. It suggests that DNA viruses arose from plasmids or transposons (which are both essentially semi-independent pieces of DNA), retroviruses arose from retrotransposons and RNA viruses arose from self-replicating mRNAs.
Oh and one more slight nitpick. As a former virologist, trust me on this. The plural of “virus” is not “virii”, it’s “viruses”.
On hesitates to admit it, but, despite the clarity of your explanation (after all, who isn’t aware of the role that retrotransposons play in the production of cheese and rap music?) I yet feel a bit baffled. Were these, then, at one time part of a cellular machinery, and somehow “got loose” and set up business on thier own?
Do you have a site/cite (scite?) for the self-replicating mRNAs?
-Ben
“My name is P-element, and I’d like to say
That I like to rap in the old-school way
I say A, G, AGTC,
AGTTGGACCTGTCATGGCAATGTGGTTCGCGTACATGC
Alu!”
-Ben
Well, like I said, elucidator, my post was a supplement to what was said already. Specifically I referenced the part of Colibri’s post that said “They are fragments of genetic material that have somehow become isolated from cells but have retained the ability to control parts of the parent form’s cellular machinery.” I reempahsized that hypothesis and provided the specific names of these fragments. So the answer to your question is “yes”.
I’m sorry if my desire not to bore people with the more technical definitions of things like transposons made my answer seem unclear. I figured that “semi-independent pieces of DNA” was enough information to address the OP without copying paragraphs from my obtuse virology textbook. It’s not exactly written for the layman.
But for the curious: Transposons and retrotransposons are both “mobile elements”. They are basically genetic sequences that can move in and out of the genome inserting themselves in different places. If this process is done through a DNA intermediate it’s a transposon, if it’s done by converting the DNA into RNA and then back to DNA again, it’s a retrotransposon.
Ben, I have a scite from the Virus Evolution chapter of Fundamental Virology (3rd ed.)
[QUOTE]
*Originally posted by DrFidelius *
**
Even if I could come up with the funding, I’m not crazed enough to inflict my wacky, unfalsifiable hypothesis on some poor, innocent grad students! If such organisms exist, they’ll probably be discovered by someone who’s looking for something else entirely.