Warning: if you read this OP, it may ruin your happiness forever.
Here’s my biggest existential problem: everything I (we) am (are) is absurd and arbitrary, and there’s nothing else it could ever be. For example, the only reason we tend to like fatty foods and sex is because that’s how our brains evolved; if evolution had gone differently, instead of fatty foods and sex we would enjoy drinking spider blood while banging our heads against a large oak tree (which, generally speaking, most humans don’t). Just change a few DNA code strands, and voila! Spider blood and oak head-banging is a fun night out!
All of you are on this message board because it fulfills the you you are now by giving you ego boosts, companionship, stimulation, fascination, et. al. If your dna was changed, you’d never have the desire to post on here again, and would instead go jump off a bridge because now your absurd arbitrary genes tell you to do that instead; it now is the ultimate fulfillment for your brain.
If I changed your ATGCCGATTAGCCGCGGCATTAATATATGC to GCATTACGGCGCGCATTATATA, you wouldn’t be at peace with that anymore, you’d only be at peace with flying south for the winter while keeping the sun in the northeast corner of your 10 eyeballs.
I think there are a few more difficulties with this than you imagine. We are the way we are because at one point it was evolutionarily advantageous to be so. Our brains like fatty foods because fatty foods have lots of energy. Our brains like sex because everyone who didn’t like sex didn’t have any and didn’t pass on any genes.
Some things about us may seem absurd, but none of it is arbitrary.
edit: On preview I see you mentioned evolution in the OP. I don’t understand why you feel that this process is arbitrary. It seems perfectly logical to me.
Life isn’t a computer program; it’s an arcade game. Sorta like Tetris. It goes by, faster and faster, and you fall farther and farther behind, until suddenly it all balls up on you and you lose.
To deal with it, you can develop a zen-like dispassion; or an Epicurean compassion; or a Stoic firmness. Or adopt a religious view. Or just get drunk and hell with it.
The world only really works on a “90%” basis. 90% of the time, the good are rewarded, the bad punished, the house doesn’t fall down, and the cow comes home in the evening. This is why civilization is possible.
10% of the time, the bandits get away with robbing the bank, the sheriff hangs the town drunk for it, and that dark cloud on the horizon is an approaching Mongol horde.
We’re human. When it’s all over, we’ll bury the bodies, and start rebuilding.
Exactly - the arbitrary nature of what we are is part of the fun. It means we get to make it up as we go along - with (well, a good deal of the time) nobody to tell us that we’re doing it all wrong.
The alternative is for the minute detail of the purpose of our lives to be mapped out for us to blindly, dumbly follow. No thanks.