Behe may not be a young-earth creationist, but ID is simply a form of creationism. It’s the same argument put forth by Paley to glorify God: life is too complex to be the product of naturalistic forces. Nor does it matter that “he accepts darwinian evolution as a mechanism- just not ALL the time” - because NO evolutionist (excepting the few strict Darwinists who may still be around) accepts “Darwinian” evolution as a mechanism ALL the time. Evolutionary theory has grown well beyond what Darwin initially proposed, mechanistically. Natural selection still acts as the statistically major mechanism, but by no means the only one. And, while you may argue that “those fundies who want to use his book & views to prove “evolution” wrong are deluded”, Behe has made no effort to correct those fundies on that point. Such certainly implies that he agrees with them.
**
On the contrary: Mainstream Science (whatever that is) makes no claims regarding “someday”. All that matters, and what scientists do stress, is that even if we never figure it all out, that does not make Behe’s argument correct by default. There *is * no default - if a theory is to gain acceptance, it must stand all on its own. Behe’s argument about complexity does not: it relies on the lack of knowledge we have today, and claims victory based only on that lack of knowledge. Behe makes no independent claims about how it can be shown that complexity must imply a designer - it is simply an assumption that he starts with, in an effort to show how evolution is, in fact, “wrong”.
**
The caricature you portray of “Darwinism” may well be. However, Evolutonary biology != Darwinism. Even Darwin acknowledged that much of what he theorized may well be tossed out some day. And, indeed, much has been. What has been retained has stood up to repeated inquiry.
I appreciate everyone’s responses. Surely there’s another thread out there where someone defends my position better than I am here. I have some pro and con evolution books that I plan to read, but they’re at the back of the reading list due to other interests. Maybe after I read those I’ll repost, but for now I’ll try to get in a few stabs with my knife at this gun fight.
First, my father’s Master’s is in Biology, with a minor in Chemistry. He had to UNDERSTAND evolution, and but that doesn’t mean he had to agree with the theory. He did, in fact, believe it back then, but has since changed his mind. There are more and more PhD’s in all branches of science who don’t believe in evolution. Look through that origins.org page and you’ll see just a few examples. I don’t think it’s time to stop the presses when someone with a Master’s in Biology doesn’t believe evolution.
Here’s arebuttal to common criticism’s of Darwin’s Black Box to attempt to answer some of tomndebb’s, Darwin’s Finch’s, and Lissa’s points and links.
I appreciate DrDeth’s, in my point of view, objectivity. I think that objectivity is the exception rather than the rule in these types of arguments. Evolutionists in some cases use condescension as often as facts as tactics in their arguments, and when you’re in the majority opinion, it can be effective. I’m sure the other side would abuse this tactic as well if they could, but when they try they end up looking like webman. Regarding the lack of objectivity, it’s obvious that it would benefit Christian’s if the evolution theory would go away, but that knife cuts both ways. When books like Behe’s come out, the first move most evolutionists make is that of an evolution apologist rather than that of an impartial party looking into the possibility that their theory has some irreparable holes. One reason for this is that throughout life one has seen everything from science to history to philosophy through the lenses of evolution. It is quite uncomfortable to rip this frame of reference away in one swift motion like a Band-Aid, right off. Shopping for origin theories is quite limited, and one would most likely be faced with some sort of unsophisticated, pre-modern creation scheme, not to mention the unpleasant implications regarding morality and responsibility. It would also mean scientist would have to lose face and say that half of what they’ve said for the past 150+ years has been B.S. Forgetting about Behe, imagine for a minute, if you will, that one day information is discovered that conclusively proves evolution false. Would it be accepted immediately by the establishment, or would it take years and years of scientists trying to ignore or explain away the information before evolution is thrown out. I’m not saying that everyone is ruled by his or her motives and no one is objectively looking for the truth. I’m saying evolutionists have as much to lose and/or gain as Christians, and as humans none of us can claim scientific impartiality. I’m sure people some do better than others.
Some observations on probability. Saying that the probability of anything that has occurred is 1, as tomndebb said, is skirting the issue. Granted, we are here, and it’s unlikely that we should have ever gotten here. I understand the idea that anything that happens the way it happens is unlikely. For example, one time when I was playing tennis, I had an overhead smash that I should have put away. Instead I hit it out of bounds against the backstop, and then said, “Got that bug,” as if I meant to hit the ball on the exact spot on the backstop where it landed rather than in play to win the point. If I had been trying to hit that spot, it would have been very improbable that I could have done it, but since I was going to claim I hit my spot no matter where the ball went, the odds were 1 that the ball was going to go where I would claim that I was aiming at a bug. If you took the area where I could hit a tennis ball and divided that by the size of the tennis ball, we would have relatively (compared to evolution) good odds of me hitting an exact spot. The probability of 1 argument works in that circumstance. With evolution, we’re talking about a DNA code that looks like it was written by an intelligent being. It can be read and “cracked.” It contains logical information equivalent to a library of 1,000 books; say for purpose of analogy, the 1,000 greatest works of literature. Reminds me of that Simpson’s episode where Mr. Burns has a bunch of monkeys typing trying to produce the greatest book ever written. “It was the best of times, it was the Purst of times! What is this drivel?!” If we’re saying the odds of us being here are .00000000000000000001, I don’t’ think it’s fair to say there have been 20000000000000000000 tries (these are DrDeth’s numbers, so if I pulled them out of anyone’s butt, it wasn’t my own). The sun may be the only star to have planets. And if we are ever able to find another star with planets, how many are going to have enough water to support carbon-based life, as scientists can’t explain why they earth has so much water. The planet would also have to be the right distance from their star to support that life? And even if it’s possible for there to be other forms of life than carbon, we’re still carbon life forms, and the odds of us having life as such is still .00000000000000000001, but you can’t include non-carbon based life forms in the 20000000000000000000 since we’re carbon based. So now we move on to the potentially limitless number of big bangs that may have occurred, like the questionable expanding and collapsing universe theory. Seems like the argument is getting on thinner and thinner ice. I think the point IDers are attempting to make with the probability argument is that in a naturalistic universe, the odds are, for all practical purposes, impossible that we should exist. I don’t think the problem can be dismissed by saying, “But we do exist, so I guess we beat the odds.” Instead of that, I’ll consider other possibilities, like something outside of nature being responsible for creating us. The problem is that the supernatural is unobservable and therefore bad science by definition. So in order to be considered a science, an origin theory has to be naturalistic and materialistic. Evolution is the most likely scenario if one rules out supernatural design, but for those who don’t rule it out, evolution is almost infinitely less likely than extra natural creation. The possibility of the supernatural having had a hand in the origin of man seems more likely to me than accepting that we, mankind, beat .00000000000000000001 odds. I will give a link to a tenable design theory rather than just criticizing evolution without offering any alternatives. I’m sure any of you who read it will love all of the Bible quotes and assumption that the reader is a “believer.” The article’s objective isn’t to present a theory. It is actually looking at both Genesis and the scientific record, but his theory to explain these two accounts is easily deciphered. The bare bones of the theory are that the universe and earth are billions of years old, with several moments of supernatural creation spread out along the way: the universe itself (big bang), plant life, animal life, man, etc. Here’s the part where you all tell me I’m an ignoramus who doesn’t know what he’s talking about and I will half agree and shelf it until I can look into the subject further.
Once again: evolutionary theory does not require that living beings developed from non-living material. Given that the principles of physics are chemistry are relatively well-understood, and that there is currently no evidence indicating that life was designed or created by a sentience, Occam’s Razor indicates that abiotic genesis is the better explanation.
Even if life were specially created, the evidence to date shows that the diversity of living things is the result of evolution. If life has in fact been shaped by a sentience, that sentience has gone through a great deal of trouble to disguise that fact. With the evidence we have, the only rational conclusion is that evolution has taken place.
Oh, I love for more reasons than that, Clive. You’ve all got to take a look at this thing, it’s a hoot! The whole thing goes back to what I was saying in an earlier post about reducing the argument to who’s better at soundin’ scientific an’ such.
I confess I skimmed past all the stuff near the beginning that had nothing to do with the scientific observations. It’s basically an explanation for those who might be swayed by the technical nature of scientific arguments that religion can sound scientific, too. It attempts to convince the reader that even though traditional translations of the Genesis creation story don’t agree at all with the observed facts about the universe, you don’t need to give up on the idea that the story represents historical fact, if you are so inclined (as you should be, ya damn heathen). Just go back to the original Hebrew words and reinterpret them. Cri-mi-nelly! The man is willing to admit that the reverent translators might have got something wrong while translating scripture under God’s inspiration! He must really have a big fish to fry if he’s willing to make that sacrifice!
The fish makes its appearance in the next section, where the author attempts to use the fact that biologic history consists of ever-increasing orders of complexity to show that life can not be explained by scientific principles:
"Increasing chemical complexity is the most distinctive feature of prebiotic evolution and also represents the single biggest challenge to explain by natural processes. The Second Law of Thermodynamics asserts that the universe or any isolated system therein is tending toward-maximum entropy, where entropy can be thought of as a measure of the disorder of the system.{19} Thus, the Second Law suggests a progression from order to disorder, from complexity to simplicity in the physical universe. Yet biological evolution involves a hierarchical progression to increasingly complex forms of living systems, seemingly in contradiction to the Second Law of Thermodynamics. Whether this discrepancy between the theories of thermodynamics and evolution is apparent or real is the question to be considered in this section. The recent controversy evident in an article in The American Scientist along with the replies it provoked demonstrates that the question is still a timely one.{20}
Harold Morowitz{21} and others have suggested that the solution to the “apparent” contradiction is found in recognizing that the earth is not an isolated system, since it is open to energy flow from the sun. One cannot, however, simply dismiss the problem of the creation of order in biological systems by some vague appeal to open system thermodynamics. One must specify how the energy flow through the system may be converted into the necessary chemical and coding ‘work’ required."
I confess, this one stopped me cold. Could he be right? I mean, the man actually opened a science book (at least to the glossary) and hauled out the Second Law of Thermodynamics, one of the most respected tenets of science for the last half millennium. Would I have to go to the highest levels of scientific literature to find out whether or not his position was valid?
Actually I only had to go to my first-year college physics text, “Physics for Scientists and Engineers” 5th edition, by Serway and Beichner, where they discuss entropy starting on page 685. After giving the mathematical derivation of the Law (the change in entropy is the change in energy lost to heat divided by the overall temperature) from existing accepted science, they do indeed state that the overall entropy OF A CLOSED SYSTEM MOVING FROM ONE STATE OF EQUILIBRIUM TO ANOTHER will increase. A closed system is one in which all influences on the system are contained in the system itself. By admitting that the constant addition of the sun’s energy (not to mention constant chemical input from micrometeoroids, many of which have been observed to contain organic compounds) means the earth is not a closed system defeats his application of the Second Law, which has nothing to say about entropy in non-closed systems. He is right, that the details of how this energy (and the incoming matter he fails to mention) compose themselves into proteins and cells remains to be worked out in detail, but it’s for sure they have nothing to worry about from the Second Law.
But let’s pretend he has a point. The mathematics of the Law hold only for closed systems between states of equilibrium, and as my book states, in bolface: “the change in entropy of a process depends only on the endpoints and therefore is independent of the actual path followed.” Translation: This law will be satisfied once everything settles out, so things could get very complex before that happens. So unless the author is arguing that the Earth has settled into a state of equilibrium (you don’t see the earth changing in any way, do ya?) the Second Law of Thermodynamics fails to apply. Even if it did, it fails to explain away increasing complexity within this non-closed system.
Once again, scientific reasoning has failed to require God to step in and make it all happen, which I’m sure the author thought was the only reason scientists studied in the first place. The Second Law will be satisfied when the apparently closed system of the universe disintigrates into heat, which will be a greater state of entropy than the ball of hot dense matter that it started with. Until then, it is free to get as complex as it likes.
Trying to cram God into science before there is an evidentiary need to do so is kind of like a car customizer welding 50’s style Cadillac fins on your late-model sports car. It doesn’t help anything, and it may do untold damage.
Again: the observations are there, folks, and evolution’s way of explaining them makes a lot of sense. Come up with a way they make more sense with God, and you’re onto something.
The day may very well come when science must admit to the active hand of God, and they will do so gladly when the evidence is solid. Until then, those who want to believe God created everything have the satisfaction of knowing that they can not currently be proved wrong (or right).
Well, except that I made that statement in a very specific context.
webman was holding forth that the odds against a whole batch of simple chemicals coming together and suddenly/accidentally/miraculously/however, spontaneously forming a one-celled animal were unimaginably huge. He might even be correct with his scenario (even if he can’t actually show how he arrived at his odds).
However, no scientist believes that a bunch of chemicals bumped into each other one afternoon and “became life.” The current hypothesis is that certain simple chemicals combined in various ways to become complex chemicals–we have seen that happen, so the probability for that action is 1. Those complex chemicals then “found a way” (to anthropomorphize a bit) to replicate themselves by maintaining partial strings when they were split apart that latched onto other simple chemicals and formed them into the complementary chains needed to recreate their original complex order. We have seen this in the laboratory (at least), and possibly in nature, so the probability for this action is also 1. So, by ignoring webman’s preposterous scenario (that no one in the scientific community believes, anyway), we have already reduced his improbable odds significantly by demonstrating that the first two events that we suspect happened have happened. From that point, we can speculate about the odds of those self-replicating chemicals taking various paths to become actual living creatures. There are different possible paths that probably have different odds and the study of abiogenesis is not nearly as mature as the study of evolution.
However, by hypothesizing about early steps in the process and then discovering those steps in action, we have short-circuited the “incredible” odds that webman insists upon by claiming an event that no scientist would accept. That will tend to reduce the odds against and increase the odds for the continuation of the speculated path of actual creation of life.
A MB isn’t much of a source, but there is a link on that page to further information. Unfortunately that link seems to be broken now. This is a correct link. The site has a lot of material on Einstein’s views on religion. On this page he is quoted as saying:
IMHO this eliminates any commonly accepted definition of “God” or “supreme being”. Something without a will would be more like a natural force than a “god”.
Regarding Darwin, this siite has a lot of good information. On this page he is quoted as saying:
Definitions of “agnostic” and “atheist” have been debated endlessly but IMHO he seems to be talking about so called “strong atheism” versus so called “weak atheism”. Meaning that he can not absolutely rule out the existence of some sort of supreme being (not being able to prove a negative) but that he has no reason to believe that there is such a thing. This page seems to further support this.
To say the Darwin and Einstein believed in “some sort of god” seems disingenuous to me. YMMV.
An attempt which does not succeed, I’m afraid. His rebuttal to the “God of the Gaps” claim is completely devoid of substance: “but…but…evoltuion has its own gaps!” As I stated before, That is irrelevant. If ID can’t stand up on its own it is not a valid theory. If ID is to become valid it must provide a falsifiable theory. ID fails to do this by claiming a “win by default”, as I mentiond earlier. It is never the case that “well, Theory A can’t explain Phenomenon B, so Theory C must be true!” Especially when Theory C, as in this case, cannot provide falsifiable experiments.
His second rebuttal operates under the mistaken assumption that “one process explains all”. As I have also mentioned previously, natural selection is the statistically primary force whcih drives evolution; however, it is not the only one. If one can show that such and such structure did not evovle through natural selection, such does nothing to dismantle the whole of evolutionary biology. The author goes on to use the example of methotrexate which “looks like”, but does not “act like” folacin as a rebuttal to the claim that a non-functional gene duplicate can interfere with a functional one. Unfortunately, methotrexate was synthetically created to do just that!
His third criticism can be seen as a continuation of the second issue: gene duplication can result in both an increase in complexity and allow for changes in function. Simply put, duplication allows for experimention.
His fourth cirticism can only be applied to the analogy, not the argument itself.
His fifth criticism is just another restatement of the first: we don’t know, therefore there must be a problem with the theory. I, myself, am no fan of “just so” stories, but one can still look at such stories as falsifiable hypotheses. Thus, they are still valid scientific entities. As new data are uncovered, the stories can be refined or outright falsified. However, as mentioned previously, even if we never accumulate sufficient data to make a claim about the evolutionary path for a particular structure, such has not invalidate the theory by which such a structure may have arisen. There are two parts of evolutionary theory which many folks seem to conflate: one is the mechanistic theories which drive evolution (these have been tested numerous times, and have passed scrutiny), and the other is represented by the evolutionary pathways along which a structure is alleged to have evolved. These latter are entirely data-dependent. In the case of molecular evolution, note that it has only been possible to even gather data at that level for a relatively short time - a few decades at most. It is logically unsound to therefore point to such as a limitation of the mechanistic theories.
His sixth criticism is a non-sequitor. It is not claimed that the “simple” versions of extant complex structures evolved into the “complex” versions. The simple versions represent a grade of organization which the true ancestral form could have taken, not necessarily the ancestral form itself.
His seventh criticism is a strawman: no one is making claims of complex systems evolving “from scratch”. He also completely misses the point that the numerous deaths “required” to evolve traits such as drug resistance in bacteria are entirel consistent with natural selection. That, and he completely misinterprets what punctuated equilibirum is.
His rebuttal to criticism #8 is not a rebuttal at all. It is not enough to state “I don’t know how that could work”, and no one would consider that a rebuttal of a theory. Those proposing thwe theory must show how it could work, while those attempting to rebutt must show how it could not. Just saying “I don’t know how that could work” is insufficient as an argument against.
He closes with some miscellaneous comments, such as, “We have never seen a new creature arise simply by random, natural processes.” Again, a strawman, as natural selection is virtually the antithesis of a random process. It is truly mind-boggling that those who protest against evolution or “Darwinism” fail to grasp this concept. It is not a random process! Granted, there are random evolutionary mechanisms (genetic drift being an example), but natural selection is not one of them.
This is how natural selection works: Fact: Variation exists between individuals within a population. I do not believe that this can be reasonably denied: you are different from me, and I am different from everyone else. Except in the case of clones, all individuals have some variation of a given trait. Fact: At least some of this variation is inheritable. Again, diffcult to deny. Fact: The individuals of a population have the capability to overwhelm the environment with offspring, where limited resources not a factor. This cannot be denied, especially if we consider the Biblical creation story: God created two individuals, yet we currently number of 6 billion individuals in (allegedly) 6,000 years or so. Alternatively, you can use Noah’s family of seven (?) as your starting point. Now, consider if no one had ever died… Fact: Resources are limited. The natural result of this is that competition for these resources must occur. These resources include food, territory, mates, water, etc. Those who fail to acquire these resources typically perish.
Now, Darwin formulated his theory of natural selection by examining those facts: Given that only some offspring can survive, those who do will, on average, be those who possess traits which yield an advantage in whatever particular environment they find themselves in (note that “environment” represents the sum of all forces, external or internal to the population, which affect an individual. It is not limited to extremes of environment and such). Since the traits which allowed them to survive are, on average, inheritable, their offspring will likewise possess such traits, which will in turn vary, and so on. Over time, then, the population will gradually change in the direction of expressed phenotypes which are best suited to a particular environment.
Note that if the process were random, then one might expect that no particular variation of a trait should yield a competitive advantage (or disadvantage), or that new forms might be produced solely through mutation. Neither of these happens to be the case.
How, exactly, does it “look like” it was “written” by an intelligent being? And how, exactly, does it translate to “logical information equivalent to a library of 1,000 books”? If I wrote out pages and pages “…AGCTAGCATCGACTCAGACTACGACTACATCACGACTA…”, it would rightly be considered gibberish. I did, in fact, simply randomly strike those characters on my keyboard. And yet, I would wager that one could find just such a string in a real DNA strand. Surely, you do not contend that my random string contains information. Or, worse, that mine does not while the equivalent DNA string does…
Thanks for the replies, especially those that didn’t make fun. I’ll be doing some reading with an open mind, and possibly come back in to Great Debates and post when I understand both sides adequately enough.