Opus1, that was excellent. I shall also use your language analogy, if I may.
It appears that the talk.origins archive is down right now, but here is a nice compilation of the criticisms of evolutionary theory and answers here http://www2.uic.edu/~vuletic/cefec.html . #4.12 describes one example of observed speciation, and links to the talk.origins pages for more (I guess we’ll have to wait for that to be up and running, but this is a good start).
One more time: Biogenesis is unrelated to evolution.
Huh? Let’s see . . . firstly, speciation occurs in nature, not in a petri dish. Secondly, are the development of immunities not indicative of selection? If not, why not?
Thirdly, speaking of biochemistry, can you please find out for me how Creationists explain protein homology? Thanks.
(1) Your first point was already addressed. We cannot accurately calculate the odds of abiogenesis when we do not know how it occurred. But, it did occur. Plus, the calculations themselves are debateable.
(2) Your second statement is false. We have seen changes in bacteria other than new immunities. Even so, new immunities developing in a bacterial population is part of evolution.
(3) Hopefully, this won’t evolve 
into a flame thread.
Is the above sentence a statement or a question? If it is a statement, speciation is not a “large part” of evolution. Speciation is simply a distinct point in the process of evolution.
Who offered that hypothesis? Two different species cannot produce live and fertile offspring, e.g. the horse and the donkey produce the sterile mule.
Although we share a large portion of DNA with various primates, 98% with chimpanzees for example, we remain different species. By the definition of the term species, we cannot interbreed.
Consider this postulation of human phylogeny. Ardipithecus ramidus evolved into australopithecus afarensis (e.g. “Lucy”) which evolved into two species. One species was australopithecus aethiopicus which evolved into australopithecus robustus and australopithecus boisei. These species became extinct. The other species was australopithecus africanus (e.g. the “Tong baby”). Eventually homo habilus came into being, followed by homo erectus, then homo sapiens.
Technically, homo sapiens came into being approximately 250,000 years ago–Chimpanzees and humans were already incompatable. Chimps were evolving under separate conditions. Between fifteen and five million years ago, the tropical forests of the Sahara receded and gave way to the savannah. Due to a lack of natural arboreal habitat, some primates were forced to become more terrestrial. Due to a change in terrain, i.e. arboreal to terrestrial, bipedal locomotion and upright posture became an advantage in survival. Due to a change in diet, the land apes (ardipithecus ramidus) developed more enamel. As speciation continued, protruding canines receded and the surface area of molars increased. Many other characteristics changed as well.
The point is that at one time there were two populations of a single species. Environmental pressures were different for these two populations. One stayed in the arboreal environment while the other was forced to adapt to new conditions. As gene frequency changed between the two populations, the two developed different phenotypes. Eventually, the two populations became different species. While one hominid branch evolved into our species, another branch ended (as is the case of australopithecus robustus). Ardipithecus ramidus shared a common ancestor with the chimpanzees of the time. Both branches continued but were subject to different pressures, ergo, modern chimpanzees and modern humans developed separately.
Statistical improbabilities are largely meaningless, as has been addressed in previous posts in this thread. Unless it can be shown that spontaneous life generation is impossible, this is a moot point. Life exists, so regardless of the odds, it happened.
Besides, I am pretty sure that most of these probabilites do not take into account the actual chemical properties of the molecules involved. Certain molecules have an affinity for certain others, making it far more likely that Molecule A will join spontaneously with Molecule B. Molecule C may not have much affinity for either A or B, but may have an increased affinity for the A-B combination. If this were not the case, it would take an incredible amount of sustained energy to keep any two atoms together. And that’s not how the universe works.
**
For one thing, bacteria don’t reproduce sexually for the most part. They may exchange genetic material, but that isn’t quite the same thing.
As for the single->multiple cells, many single-celled organisms reproduce via cell division. If such an organism formed a colony, it’s not a great step from there to cell differentation (certain cells develop certain traits which allow them to specialize in a given function, (e.g., food gathering or mobility), and voila, you have the beginnings of a multicellular organism.
Evolutionary change is composed of baby steps over a great length of time (if you even think you have a concept of how long a billion years is, or even a million…you don’t), not gigantic leaps from amoeba -> man.
>Most people use the England moths as an example of
>evolution, with their changing colors due to pollution.
>Which moth is more evolved, however? <
I really didn’t want to jump into this, but as the man-in-black (played by the Governor of Minnesota) in an X-Files episode called ‘Jose Chung from Outer Space’ summed it up:
“Your scientific illiteracy makes me shudder.”
The notion of “more evolved” is a complete misunderstanding of Darwin’s theories of natural selection, which have been amply demonstrated in the fossil record. Darwin says taht it is only a question of living things being better adapted.
Stephen Jay Gould in his book “Full House,” as well as in other writings, attacks the egocentric notion that evolution leads to higher and higher orders of complexity or perfection – as human philosophers have long posited.
In recent years Gould’s main concern seems to be that humans continue to believe that they’re the “highest” form of life – and the arrogant philosophy that results. As he correctly indicates, bacteria have won the evolutionary battle based on count and diversity – and they’ll be here until the sun becomes a nova. Can’t say that for homo sapiens.
Read and understand evolutionary theory before trying to find metaphysical reasons that it doesn’t “work.”
By the way, Opus1, I’m in agreement with lissener on the language comparison.
HideoHo wrote:
This has very nearly been done!!
In the 1950s, Fox and Miller discovered that electrical discharges (“lightning”) could turn the basic chemicals once thought to exist in Earth’s atmosphere – methane, ammonia, and water vapor – into amino acids.
It was later discovered that amino acids baked in ultraviolet light (“sunlight”) would turn into short, protein-like chains called proteinoids.
Finally, Fox discovered that if you put a hot lump of proteinoids in a dilute saline solution (“ocean water”), it would spontaneously give off these little thingies called proteinoid microspheres.
Proteinoid microspheres have so many properties in common with real, living bacteria it’s not even funny. They “eat” and “grow” in that they absorb more proteinoids from their environment. They even undergo a process of “division” eerily similar to cell division. If they had DNA, or even RNA, we wouldn’t hesitate to call them “alive.”
Note that the matter of abiogenesis still isn’t completely settled, though. Another candidate for the progenitor of living cells is the “coacervate,” and another possible (though much less likely) candidate is the “liposphere.” But for my money, if I had to bet on one of them, it’d be the proteinoid microsphere, hands down.
Reminds me of the ending of the movie Diner…Paul Reiser’s character is not buying the evolution theory…goes something like this:
“…Millions of years ago, in a swamp, their was an amoeba, and this amoeba crawled onto land, and now we have some guy on the corner in a winter coat yelling, ‘Taxi!’…???”
Ummm…not quite…
Anybody got a banana? I think I’m becoming less evolved…
So HideoHo you want bacteria to turn into people (or some other “higher” vertebrate) don’t you? Well I don’t think that’s going to happen. You see, bacteria are nearly perfect, for what they are! Their genomes are just to small to allow for any “evolutionary leaps”. However, your genome and the genomes of all those other “higher, more evolved” creatures (compared to the lowly bacteria that has only been here since the beginning and shall be here till the sun turns into a red giant) have REDUNDANCY and so CAN “evolve”. Did you know that some bacteria have a doubling time (one bacteria turning into two bacteria) of under 20 minutes!! Do you know how many spontaneous mutations can occur within a population of bacteria, with a 20 minute doubling time? You mention that bacteria have only evolved resistance to some antibiotics. As fast as they mutate it’s suprising they haven’t become resistant to ALL antibiotics already. The cool thing with bacteria is they not only produce “new” bacteria capable of antibiotic resistance, but they keep the “old” ones as well!! THIS IS THE AGE OF BACTERIA HIDEO!!! ALWAYS HAS BEEN AND ALWAYS WILL BE!!!
I could go on about bacteria, but I’d like to throw something else your way. Since you can’t seem to comprehend how a photosensitve cell could turn into an eye, do you think you could understand how a few jaw bones could become hearing ear bones? It’s amazing how some gill supports could become jaw bones, could become ear bones. Let me know if you’d like to learn more, and then we can take a spin on that wild ride!!!
HideoHo,
This is a very different audience than you are used to. The book is not too detailed or complex for many people on this board, it is to simplistic, and elementary. The startling conclusions you have just learned about have been brought up more than a dozen times each on previous threads. I won’t bother to link you to death with references.
But do be very careful about assuming that your information is more accurate, erudite, or consistent than that available to the posters on this board. The hard facts are that many people who respond here are far better read than you and I on the subject of Darwin’s Black Box. It isn’t a black box to them, they work every day mapping and manipulating the very stuff of genes, and evolution. Telling them what the relative probabilities of something happening is mildly humorous, at best.
Protein homology has been mentioned several times. This question will come up over and over if you preach evolution by design, or Creationism, or denial of evolution, or any of the many other anti-Darwin philosophies here. The really funny part is that most Creationists don’t understand what the words mean, and explaining them involves six or seven months worth of Molecular Biology classes at a good University, or a few years keeping up with the news of Science.
The Eye was evolving long before it was an eye. Plants show phototropism. The sun dominates life above the deeps of the ocean, and any improvement in an organism’s ability to use light can have a benefit. The Human eye is not all that good a design, either, if you really examine it. Put the blood vessels behind the retina, add flow through filtering in the interior fluid, and move the fovea away from the visual field, and you are talking design.
Missing links is a useless term. We have lots of examples of variation within species, and lots of examples of genera of individual species which are essentially similar in both taxonomy and biochemestry, (that ol’ boogey man protein homology) while dissimilar in sufficient amount to be designated divergent species. There are even examples of species that are infertile among members at the extreme limits of their range, but fertile within closely neighboring individuals. There are also examples of bird species that are genetically isolated by behavior alone, and yet show the genetic results of that isolation. Those are as much “missing links” as the much-discussed man/monkey. But they aren’t missing links, they are simply living organisms, which either will or will not procreate before death.
Species is an artificial division. So are Genus, Phylum, and Kingdom. The division is an imposed system. When we find an exception to the system, we examine it closely, and may change the system. Infertility is not an unchallenged definition of separation for species. There are several different and highly competitive methods for taxonomic assignment under current use. The phenomenon of life does change over time, and imposing our system upon it helps learn what life is, and how it changes.
To claim a particular inaccuracy exists within the current model of evolution is certainly a point of valid importance to biology. Evidence of such an inaccuracy would be received with a great deal of interest, and independent examination. However to assert that the entire model is incorrect is a profound claim, and would need extensive hard evidence to be given any credence at all. Many decades of investigation and effort support the current model, and many investigations have proven it to be consistent. Yet every day someone on the Web announces the imminent demise of Darwin’s theory. Most biologists don’t even read the articles. If you want your own voice to be treated differently than the voices of those who replace scholarship with stridency, you must show exemplary scholarship, and openly available evidence. So far, that is still lacking.
I reiterate the warning attributed to me here, the heathens at The Straight Dope Message Boards are really smart.
Tris
Just want to thank you all for the interesting discussion. Sorry I was elsewhere earlier this afternoon (not that this lawyer would have added anything significant.)
One thing I thought of concerning Hideoho’s observation that the numbers were too big (or the odds too small) to be believed – I had a similar problem when Mrs. D started getting seriously into astronomy. “How many light years did you say, dear?” Unfortunately, lots of hard science doesn’t “dumb down” all that well. After a certain point you have to accept some of it (dare I say it) on faith.
Excuse me now while I go to quart.
What an odd assumption- why do you think that no one here is a biochemist?
Would it be unduly harsh of me to point out that this is SDMB, not LBMB?
Anyway, since you have read this book on the biochemical evidence against evolution, and since protein homology (thanks, andros!) is a major piece of biochemical evidence for evolution, and since Behe would therefore have been deeply remiss in not addressing protein homology, then you know all about it, right? So why not quote the parts of Behe’s book which explain why protein homology isn’t really evidence for evolution?
Why don’t you at least acknowledge that you have been asked to explain protein homology? You’ve been asked three times now, fer Pete’s sake! Either put your money where your mouth is, or admit that you have no idea and Behe has no case!
-Ben
Someone brought up how random mutation could only change one or two genes, not the great number that would be needed for a major structural change.
I am definitely not an expert or particularly well read on genetics, but I read an explanation about how changing one tiny part could rewrite a whole string of genetic data.
As an analogy, consider this string of letters as representative of a gene.
AGCATAGAAGCCTAGGATTTACGGAGA
Now, say only one of these letters can be changed, dropped whatever. That’s not going to make a big difference in the information the gene expresses.
Wrong. That string of information is subdivided into groupings of those elements, the groups are what’s important - in a sentence it’s the words that are important, not the individual letters. So let’s say these bits of information are grouped into threes.
AGC ATA GAA GCC TAG GAT TTA CGG AGA
AGC means one thing, ATA means another, etc.
Now a random cosmic ray knocks one of these letters out, let’s say the first T. It is STILL going to be grouped into threes, not the same group of 9 ‘words’ with one being a letter short.
Take that T out, and you get this instead…
AGC AAG AAG CCT AGG ATT TAC GGA GA
By removing that one letter, you have changed most of the ‘words’ in the sentence, making it mean something completely different. One minor change has rewritten the entire thing.
It’s a terrible analogy. It’s even a terrible analogy in the way that Behe actually proposed it.
You should read “Tower of Babel”, Robert T. Pennock, ISBN 026216180X. He discusses this flawed analogy on pages 168 and following.
Individuals don’t evolve; populations do. So your one tortoise is not realistic. Evolution takes time and generations, so your tortoise shouldn’t be expected to make it across the highway; maybe its descendants could.
Consider it with the animal that Behe used, groundhogs, and think of it with 100,000 groundhogs. They cross the first lane; the slaughter is terrible. But some of them are just plain lucky, some ** pause between lanes 1 and 2 and breed back to a population of 100,000/.b]. Then they set out across lane 2. Again the slaughter is terrible, but a few make it across.
Repeat for all lanes, letting the population breed back to 100,000 groundhogs between each pair of lanes. By the time they are crossing lane 10,000 most of them are good at dodging and/or jumping, and some of them are smart enough to wait until cars aren’t coming. A good large portion of them make it across because they are the descendants of groundhogs that each made it across one lane, and there’s been selection for groundhogs that have some method of doing that.
By the time they cross lane 20,000 they are artful dodgers, or look for cars and don’t start across the lane until no cars are coming, or have developed tremendous muscular legs with which they jump across the lane above the cars in one bound, or something. But almost all of them make it across.
Think about whether the book is really not religoius or is a religious book in the disguise of a scientific book.
Have you browsed Behe’s Empty Box and A Few Links about Michael Behe & DARWIN’S BLACK BOX?
lissener, I bet you’d like Tower of Babel; he devotes most of chapter 3 to a discussion of the analogies between the evolution of languages and the evolution of species.
Yup. And it was caclulated wrong. There’s several discussion of this at http://www.talkorigins.org (which seems to be down right now, or I’d post a link right to it). And it’s irrelevant (though somewhat related) to the theory of evolution.
You should do dome more homework. I’ve read Behe; what have you read by his critics?
To be fair, Behe does have substantive credentials. And his reputation is perhaps relevant and perhaps an ad hominem irrelevancy.