Michael, you are definitely NOT a potential customer of mine. You could be me (I’m doing it with an old boombox and my amp through the boombox’s headphone jack.) but not a customer.
He has, except that he doesn’t pretend to know stuff, he actually does know it. The stuff that he doesn’t know, he confesses that he doesn’t know.
Needless to say, his posts stand out quite a bit on those other boards because of this.
Hey, Lego!! Lego, remember that DNA test they did on me?
ACTGATCGATGCTACGTAGCTAGTGTATGTATCGCGCTTATCGATCGATGCTCGTGCTA
"Genome property of Tyrell Corporation. Copyright 1999."
TATTAGCTACTAATCTCGCTCTATGATCGATCGTCGACTGATCTCTTACTACGTTCGAA
"Model: Nexxus 5. Type: Technical/Professional."
TGTGTTCATGCGTAGTATTCGCGCTAATTCGCATTCTTCGATTAAGGGGGGATCGACTC
"Incept date: July 20, 1999. Preset life-span: Indefinite."
I didn’t say I’d never buy one, just that I’m a college undergrad, I don’t need them, nor will they fit in my room.
But if/when I buy them, I’ll talk to you first. Deal?
This thread is wonderful.
When we were trying to decide which model Honda to buy, I spent a little time on the car nut newsgroups. Apparently, it isn’t okay for me just to want a reasonably safe ride that will get me to work and back and to the grocery store. Oh no. This is to be sneered at. I have to care about PERFORMANCE and power and how a modified version of this model did on some specialized racetrack in Europe with a professional driver. And it didn’t matter that we might want four doors for, say, easy access to the carseat my son sits in. Because only the v6 coupe is worth buying and anyone who doesn’t immediately choose its performance over any other feature is an idiot, not to mention a complete pussy. And by god, this wasn’t just the opinion of these folks. No, it was, apparently, well-nigh a god-given set of facts. And they have the statistics to throw out there to prove it, damnit
Thank god I didn’t have the audacity to express an interest in cupholders.
Legomancer, I noticed that you posted using the Rant-Agent 5000™ 2.6. That works OK in a soft environment like IMHO. I suspect, however, that if you really want to get our attention, here in the BBQ Pit, you ought to consider switching to EatShitAndDie 6.6.
Produced by Caprine Felchworks, it delivers not merely good adjectives, but inspired verbs, devastating adverbs, and turns of phrase that are simply harrowing. jarbabyj, is using the version 6.6.6 in beta, of course, but you can still see the base work that went into the version currently in distribution. Rant-Agent does OK on the basic message. It conveys the general thoughts that are troubling you rather effectively. However, there is no verve, no style. Is simply is not up the the standards of a professional location such as the SDMB BBQ Pit.
EatShitAndDie has several add-on packages that truly make it memorable. Its table of Effective Curses is surpassed in the industry only by the Sod Off 99, but it is superior to Sod Off in nearly every other capacity. Had you made use of EatShitAndDie’s exhausting search/link function, you could have dropped in several direct examples culled from the entire internet rather than having to laboriously type out your own trivial complaints in the OP.
That sort of do-it-yourself “homework” was more than satisfactory in an early assignment of high school English, of course. However, to truly lay down a fine rant, here, you need to avail youself of the services of a professional tool. (There are those who have the temerity and bad taste to come to this MB with such shoddy products as the JohnJohnVenomSpewer with its customizing Waaaaaah pedal, but I trust you have more self-respect than that.)
Yeah, sure. I get 'em for wholesale so I’m HAPPY to sell 'em to you for retail. Aw, hell, you’re a pal–I’ll knock ten percent off. You can have 'em for a deuce and a quarter.
*tomndebb is a god (“JohnJohnVenomSpewer with customizing Waaaaaaaaah pedal”? Genius. Sheer genius).
There. That said, I must agree with the OP. Why do i need that stuff, anyway?
I don’t have a DVD player. Hell, right now I don’t even have cable. My VCR works, my computer works. We’ve got a Sony Discman around here somewhere…oh wait, I know where it is. It’s velcro’d to the dashboard of my car, because my car has no tape player, let alone a CD player. And we won’t talk about the cupholder that broke about a week after we got the car, or the lighter that never worked. Ever.
But I’ve got wheels, tunes, videos, and internet access. What the hell else do I need?
Okay, apparently I need CodeChecker2001.
You people…
You all think you know so little.
Well, I know less than any of you!!!
Ha !
“You’re dead. You’re all dead.” – Frank Sinatra
Don’t get me wrong, I like good sound.
But for $250,000, those speakers had better clean my apartment and fellate me on demand.
And dammit, on top of that, they’d better sound good, too.
Dr. J
Feh. Mercury Rev’s latest is nothing compared to their stunning first album, Boces, availible as an import only.
::D&R::
What really happened is that it gave forums(literaly) for people to expound on topics they are experts on.
You see, I’m an expert in this field…kidding!