Neanderthals + Cro-Magnon=Children?

[trouts1]

Jois:
And then what about this? “Not arguing against “Out of” but seeing a possibility for Out of’s to be mixing with Asian locals and contributing to the pool.” Who were the local Asians?

I’m trying to sort that out but it’s not easy for lack of consistent naming across Asia, Africa and Europe.
Time line with skulls for erectus types
Note the skull and date variation, they are extreme. Try to match up types here with types in the link below.

I don’t believe there was no Neanderthal in Asia. [I will agree there is no exact match for the European type.] I’d guess there was a hybrid without the dominant European features but can’t prove anything. I’m also disclaiming allegiance to OOA as a complete explanation. I think there were waves OOA and that some groups mixed and developed multiregionaly and include Neanderthal to a limited extent in the mixing.

There is not allot of evidence outside of what I have mentioned above for a Neanderthal and modern mix but the evidence that exists is striking, Lapedo. There was an Ice Man program on Discovery last night and similarly (to the limited evidence for mixing on N and Moderns) there appeared with him 1 piece of evidence that changed everything - his ax. It blew apart all prior evidence. [Actually added to the body of evidence but changed all dating for the period overnight] Why was there no single piece of evidence found before Ice Man of a process so technical as smelting of bronze or find an actual article in a stratum that would have fixed dates properly? Obviously the answer is evidence is tough to find. The link below is suggestive of just how little. On that link discount all HS references and there’s just about nothing left. For Asia anthropologists are working with very few artifacts so guessing who made them is very questionable. It also leads to typing by classification and possibly multiplying of errors. The excellent site below is by a UCB professor and researcher and he won’t assign names and I don’t blame him.

The use of evidence in Asia could be like what happens for Neanderthal and moderns in Europe where the assumption of a site without fossil evidence is typed by artifacts into Mousterian and Aurignacian influence and thereby assuming the makers based on deposits elsewhere. So a somewhat questionable Neanderthal looking rib and tooth in an Aurignacian layer becomes Neanderthal by default. “It can’t be the result of a mix because of no prior evidence” and this would be an example of mis-typing. We can’t argue against typing but it can lead to errors when taken as gospel. There are know mixes of Mousterian and Aguignacian and the makers undefined, but the general period is Neanderthal No one wants to give poor Neanderthal the brain to copy a better edge from Moderns.

The link below lists all fossil evidence and as you can see its very slim picking’s. I’d like to find links for other complete fossil evidence listings for Europe but have none so far. Complete fossil evidence record listing for China

So I’m going with waves of OOA and multiregionalism. It seems reasonable to claim some archaic’s could be mixtures of Neanderthal and archaic or Neanderthal and erectus and even Neanderthal and early sapiens and base that on skulls and artifacts.

And further:
Stringer wants to disclaim Neanderthal did not bury his dead with ceremony. That’s completely false but the position supports his larger arguments so he uses it to distance Neanderthal from Moderns. There are lots of sites with evidence for Neanderthal burials as in bones buried in the ground with red ochre. He wants to place a stake in the ground with a single Neanderthal mtDNA typing. That’s senseless and he’s been called on it. He may be proven right in the long run with new evidence but what he has is not complete. There can be other mtDNA types found in the future which just as easily discount his assumption-based theory. There could have been the weaning out of traits and markers (alleles) he’s basing his argument on. No mtDNA will probably every be found for archaic’s and some of these could
be mis-typed away from Neanderthal.

So I’ll be looking for more evidence before I’d exclude mixtures of Neanderthal and Homo sapiens. I’ll agree in broad sense that they eventually split genetically and its traceable but from that I don’t agree that there was no early mixing and that mating was impossible.

[system]

And then what about this? “Not arguing against “Out of” but seeing a possibility for Out of’s to be mixing with Asian locals and contributing to the pool.” Who were the local Asians?

I’m trying to sort that out but it’s not easy for lack of consistent naming across Asia, Africa and Europe.
See:Time line with skulls for erectus types Note the skull and date variation, they are extreme. Try to match up types here with types in the link below.

I don’t believe there was no Neanderthal in Asia. [I will agree there is no exact match for the European type.] I’d guess there was a hybrid without the dominant European features but can’t prove anything. I’m also disclaiming allegiance to OOA as a complete explanation. I think there were waves OOA and that some groups mixed and developed multiregionaly and include Neanderthal to a limited extent in the mixing.

There is not allot of evidence outside of what I have mentioned above for a Neanderthal and modern mix but the evidence that exists is striking, Lapedo. There was an Ice Man program on Discovery last night and similarly (to the limited evidence for mixing on N and Moderns) there appeared with him 1 piece of evidence that changed everything - his ax. It blew apart all prior evidence. [Actually added to the body of evidence but changed all dating for the period overnight] Why was there no single piece of evidence found before Ice Man of a process so technical as smelting of bronze or find an actual article in a stratum that would have fixed dates properly? Obviously the answer is evidence is tough to find. The link below is suggestive of just how little. On that link discount all HS references and there’s just about nothing left. For Asia anthropologists are working with very few artifacts so guessing who made them is very questionable. It also leads to typing by classification and possibly multiplying of errors. The excellent site below is by a UCB professor and researcher and he won’t assign names and I don’t blame him.

The use of evidence in Asia could be like what happens for Neanderthal and moderns in Europe where the assumption of a site without fossil evidence is typed by artifacts into Mousterian and Aurignacian influence and thereby assuming the makers based on deposits elsewhere. So a somewhat questionable Neanderthal looking rib and tooth in an Aurignacian layer becomes Neanderthal by default. “It can’t be the result of a mix because of no prior evidence” and this would be an example of mis-typing. We can’t argue against typing but it can lead to errors when taken as gospel. There are know mixes of Mousterian and Aguignacian and the makers undefined, but the general period is Neanderthal No one wants to give poor Neanderthal the brain to even copy a better edge from Moderns when shown.

The link below lists all fossil evidence and as you can see its very slim picking’s. I’d like to find links for other complete fossil evidence listings for Europe but have none so far. Complete fossil evidence record listing for China

So I’m going with waves of OOA and multiregionalism. It seems reasonable to claim some archaic’s could be mixtures of Neanderthal and archaic or Neanderthal and erectus and even Neanderthal and early sapiens and base that on skulls and artifacts.

For support:
Templeton interprets
Templeton’s expanded case herethe genetic data used to support the Out of Africa theory differently.

To him, the evidence suggests unbroken interbreeding, not a complicated scenario that requires people to migrate en masse out of Africa, to fragment and then to annihilate other established groups. “There wasn’t an Out of Africa event,” he says. “It wasn’t even a close call.”

Templeton is a bit extreme but he has justifiable arguments.

AND: From Scientific American

In fact, examinations of modern human nuclear DNA undermine the out- of-Africa model by suggesting that some genes have non-African origins. University of Oxford geneticist Rosalind M. Harding studies variation in the betaglobin gene, certain mutations of which cause sickle-cell anemia and other blood diseases. Harding found that one major betaglobin gene lineage, thought to have arisen more than 200,000 years ago, is widely distributed in Asia but rare in Africa, suggesting that archaic populations in Asia contributed to the modern gene pool. And studies of the Y chromosome by Michael F.
Hammer, a geneticist at the University of Arizona, indicate that prehistoric population dynamics were much more complicated than simple replacement. His results reflect migrations both out of and back into Africa.

The OOA people do not mention the above finding.

Also from the above link:

But Wolpoff remains convinced that the multiregional evolution hypothesis best explains the pattern and process of human evolution (including the shared features of the fossil skulls shown above); he contends that these middle-ground models can be subsumed under multiregionalism.

The OOA people do not account for skull differences which are unsupportave of their case.

Here For DNA Debate Links
Here For ["]http://www.ivsla.unive.it/Istituto/Convegni/Origini/Origini.html]]( [url="http://www.ivsla.unive.it/Istituto/Convegni/Origini/Origini.html) Abstracts of INTERNATIONAL SYMPOSIUM, The Origin of Humankind All the heavies are there, Stringer, Cavalli Sforza, Pinker, Wallace, Paabo etc. Excellent overview.

And further:
Stringer wants to claim Neanderthal did not bury his dead with ceremony. That’s completely false but the position supports his larger arguments so he uses it to distance Neanderthal from Moderns. There are lots of sites with evidence for Neanderthal burials as in bones buried in the ground with red ochre. He wants to place a stake in the ground with a single Neanderthal mtDNA typing. That’s senseless and he’s been called on it. He may be proven right in the long run with new evidence but what he has is not complete. There can be other mtDNA types found in the future which just as easily discount his assumption-based theory. There could have been the weaning out of traits and markers (alleles) he’s basing his argument on. No mtDNA will probably every be found for archaic’s and some of these could
be mis-typed away from Neanderthal.

So I’ll be looking for more evidence before I’d exclude mixtures of Neanderthal and Homo sapiens. I’ll agree in broad sense that they eventually split genetically and its traceable but from that I don’t agree that there was no early mixing and that mating was impossible.

Some links of the issue::
Introduction to Evolutionary Biology.Get the SD on alleles here.

How are traits passed from Scientific American. Excellent Get your Crick and Watson fix.
ATCGATCCTTGGGAAATCGATCGGAAGGAATCCGGA
Ray (What is that your thumb prin

[Jois]

Mipsman says: “Jois, I wonder if a more appopriate model of Cro-Magnon - Neanderthal
interaction would be closer to the eventual assimilation of some coastal Indian tribes into the California Anglo/Hispanic culture.”

Probably, I haven’t seen anything in the reading I’ve done that anything “nice” occurred at these ancient meetings.

I’d like to see more information on Neanderthals and Cro Magnons at the eastern end of their range. Saving that for later!

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[Jois]

The neoteny info is first rate, thank you, Trouts1. So is the rest of the birthing info. I was curious about this since in the US of A, at least, about 15-16% of all births are done as ceaserean(spelling???)sections.

Not all c-sections are done because the baby is too big to make the journey out, there are lots of reason. However mismatch between the baby and mother is one reason. Even for humans the match is a close one and the baby doesn’t just drop out, but makes a turn and twist to fit through the birth canal and at some point the neck looks about 12" long.

I hate to even think of what Neanderthals went through.

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[Jois]

Trouts1, Are your resting now? I’ve finally begun to make sense of Stringer and the quotes from your 2/28/00 posting as well as the research bits that the multiregionalists grumble about.

Also we know what Neanderthal was - cold weather adapted. Why should he have participated in the eastern expansion? Wasn’t interested in more temperate climes?

I still want a clearer picture of the ice ages and what Europe looked like-that a whine!

Can’t do too much with the liger/mule arguement, even domesticated-turned-ferrel cats have been observed to kill off the newborn of rival males. It is more than that five minute slip in the sheets, it is the investment of 4-5 years of the female’s life and reproductive life. Expensive then as it is now.

Interested or should we quit here?

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[trouts1]

Link for below:
During the Ice Age from about 35,000 years ago until about 11,600 years ago, sea levels were lower due to the water in the glaciers.

At the peak of glaciation, about 18,000 years ago, sea level was about 85 meters lower than it is now (which is about 50 meters lower than it was when the Ice Age ended about 11,600 years ago).

At 18,000 years ago, the Earth looked like this map from Earth and Life Through Time,
by Steven Stanley, (Freeman (2nd ed) 1989):

http://users.rcn.com/trouts1/sd/un.jpg

Glaciers of about 20,000 years ago

[img]http://users.rcn.com/trouts1/sd/iceage3.jpg

are shown in dark blue, blue, and light blue
in this map from The Times Atlas of World History (Times Books (4th ed) 1993).
Red shows the extended land area due to low sea levels about 20,000 years ago, and
green and yellow show areas favorable for human habitation in wet and dry periods, respectively. The two turqouise squares show the locations of the Sphinx-Giza complex at the mouth of the Nile River, at the intersection of the favorable Asian and African areas, and Gora Belukha in Central Asia, which may be known in China as Kunlun Shan, home of Xi Wang Mu, the Queen of the West, and in India as Su Meru, home of Indra.
In Eurasia, during the dry period of the Ice Age, most people probably migrated to the large land mass of apan-Korea-China-Southeast Asia-Indonesia-South India, with some highly cultivated spiritual people staying in the glacier-covered Altai Mountains.

Gora Belukha, 14,783 feet, the highest Altai Mountain, is in Siberia near Mongolia, China, and Kazakhstan.

[trouts1]

Should have been:

http://users.rcn.com/trouts1/sd/un.jpg

[trouts1]

Jois: The pictures you mentioned above I think is of Peking Man. For the picts above - there are better but could not find them quickly. Note above you could walk to Japan England and all over Indonesia.

For Spokes args:
I take his point and think that Neanderthals and Moderns who shared the same range probably had different life styles but have mixed. Remember that I’m not convinced on the DNA evidence that he cannot mate = late Neanderthal & early Moderns.

That brings up the whole basket of archaics which mipsman was mentioning. I’m seeing the possibility of some archaics being mixes. Archaics are a very confused group and I can’t sort them out. You say Neanderthal is a cold weather adaptation and I used to agree but am waffling at least as far as the “classical” Neanderthal being the only flavor. The more northern Neanderthal may be cold adapted but there may be Neanderthal adaptations or variants that are lumped in with archaics especially more south through Asia and Indonesia. I tried to find a taxonomy for clearing up some of this naming inconsistency but could not find anything useful.

The other thread is wicked broad and too much to deal with. Its like your asking for the String Theory of Everything for anthropology.

[Jois]

Gee, I guess you are still interested!

I do have to print all that and read it more carefully.

Be back soon.

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[trouts1]

Just in case you missed it. My last long double post’s are not the same post. The second has much more info. I asked mipsman to delete it but he got busy.

In fact, examinations of modern human nuclear DNA undermine the out- of-Africa model by
suggesting that some genes have non-African origins. University of Oxford geneticist
Rosalind M. Harding studies variation in the betaglobin gene, certain mutations of which
cause sickle-cell anemia and other blood diseases. Harding found that one major betaglobin gene lineage, thought to have arisen more than 200,000 years ago, is widely distributed in Asia but rare in Africa, suggesting that archaic populations in Asia contributed to the modern gene pool. And studies of the Y chromosome by Michael F.
Hammer, a geneticist at the University of Arizona, indicate that prehistoric population
dynamics were much more complicated than simple replacement. His results reflect
migrations both out of and back into Africa.

From the Stringer comments:

“No mtDNA will probably every be found for archaic’s and some of these could be mis-typed away from Neanderthal.”

What I’m getting at here is archaic’s are generally too old so no mtDNA will be available. But if there was it would be
mis-typed away - away from Neanderthal. It would be said that the layers are mixed up because the genes are shown to be ancestral to moderns and that’s not Neanderthal. It would go to archaic. The archaics are a possible key. They are the /variants/proto’s of larger established types. The China site guy Dlatier won’t type them. I’m beginning
to think that there needs to be more typing, cross typing and then matrix typing.

From my last post: Science off the link http://www.innerx.net/personal/tsmith/iceciv.html

The assumption that human mitochondrial DNA is inherited from one parent only and therefore does not recombine is questionable. Linkage disequilibrium in human and chimpanzee mitochondrial DNA declines as a
function of the distance between sites. This pattern can be attributed to one mechanism only: recombination. … Many inferences about the pattern and tempo of human evolution and mtDNA evolution have been based on the assumption of clonal inheritance. These inferences will now have to be reconsidered. …

[Jois]

BTW: Watson - the younger of Crick and Watson fame, has retired from the Human Genome Program. Just getting older and he is still head of Coldspring Harbor Labs - a big job in itself. Can’t remeber the name of the new guy on the HGP.

I hate/love to hammer away at this:
" …take his point and think that Neanderthals and Moderns who shared the same range probably had different life styles but have mixed." (From spoke, I think)

A sperm isn’t a big investment, but an egg is, as is a pregnancy.

In hunter-gatherer societies the pregnancy rate was every 4-5 years. With the kinds of food available for hunter gatherers not very suitable for babies, the woman probably breast fed her babies longer than women do now and longer than women did when a society turned to agriculture (gruel became baby food so women breast fed shorter periods and reproduced more often.) Breast feeding has some kind of anti-ovulating property so the hunter gatherer woman would not be breast feeding one and carrying another.

Neanderthals did not farm and most likely fit the hunter gatherer profile for reproduction.
It is too big an investment to be reproducing children outside of her chosen tribe/group when the woman might not even have the Cro Magnon father, for example, to help her by providing food.

It makes more sense for the woman’s own tribe to kill off non-tribal babies (like male cats did mentioned above) have her quickly return to ovulatory pattern and become pregnant again by the correct kind of mate.

Think it over.

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[Jois]

Mipsman mentioned OOA out of fashion - and it was at some point, all new ideas have a struggle getting the mainstream, but it has very wide intellectual support now. One scientist compared visiting a multiregional conference a lot like attending a flat earth society meeting. Things have changed.

Multiregionalism has a little quirk that needs mentioning, too. I have to tell it in story form: When Darwin’s ideas were catching on a lot of people figured that since we were created in God’s image we were the pinacle of His creation. While all this monkey business might seem odd, we were the best, the top of the tree, the end result of all this evolutionary goings on. Everything pointed to US.

Multiregionalism is a continuation of that glowing idea. All over the world, regardless of the conditions or time left isolated from the others or with other nearly human groups or any other conditions we all became human beings. Ta Da! A sort of Manifest Destiny…

Population geneticists say - “well, well,” and then make a list of what would have to and have not to be in order to get US all over the world almost exactly alike.

1. There would have to be a solid “population density” all over the old world at anytime to sustain interbreeding and to maintain the normal “give and take” of the genes.

2. No geographical barriers to this mating urge. No glaciers cutting one group off from the next, for example, no deserts, water barriers.

3. The different groups would have to be willing to share their genes.

4. And that this “rosy” vesion of different hominids evolving globally towards the same happy goal has some biological precedent. Oh, yes, new species usually just radiate out from the center of origin and keep on going. The multiregional hypothesis figures that the gene swapping occurs locally group to group to group and back again.

OOA say modern humans evolved out of 7,000 females - and spreading that number of females over three continents for local exchange of genes back and forth, wouldn’t provide enough coverage…

---

nap attack

---

Are you driving with your eyes open or are you using The Force? - A. Foley

[trouts1]

I agree with your case for the difference of life styles as a broad generalization over the period range of Neanderthal and Hs+ and that life style is somewhat defined and different.

That does not exclude mixing.

Your case is addressing the adaptations at the endpoints for Neanderthal and Hs+. That does not negate the case I’ve made in prior posts for the period I make my case for. The infanticide is too speculative for me.

Mipsman mentioned OOA out of fashion - Things have changed.

I’ll still rest on my posts above supporting a mixed OOA and MULT as I’ve outlined.

Multiregionalism has a little quirk that needs mentioning, too. I have to tell it in story form: When Darwin’s ideas were catching on a lot of people figured that since we were created in God’s image we were the pinnacle of His creation. While all this monkey business might seem odd, we were the best, the top of the tree, the end result of all this evolutionary goings on. Everything pointed to US.

No appeals to God stuff please - this is not GD. As for the “pinnacle” - a case that is just as valid can be made for bacteria or cockroaches.

For the:

Population geneticists “list” to US all over the world almost exactly alike. And the 4 points.

For “solid density” & barriers etc: The time it takes for genetic diversity swamps the time periods your talking about. A local population could come and go (as in move not die out) or advance and recede before barriers and still maintain its pool to mix at a later time. The time periods for erectus, archaics and Neanderthal are much greater than the barriers.

For: “The different groups would have to be willing to share their genes.”
They did. This happened with all the diverse erectus’s and archaics. From what I see erectus type has more diversity than N to Hs+.

For: “Oh, yes, new species usually just radiate out from the center of origin and keep on going.”
This is rigid OOA ??

For: “The multiregional hypothesis figures that the gene swapping occurs locally group to group to group and back again”
What’s unreasonable about this?. People move around.

For: " OOA say modern humans evolved out of 7,000 females - and spreading that number of females over three continents for local exchange of genes back and forth, wouldn’t provide enough coverage…"
Not sure where you going here. I’ve seen a few well know anthropologists say 2000 M & F. If your saying that’s true and all Moderns developed from this one group that’s plain wrong. See my posts and links above. There are too many holes in that to be valid.

[Jois]

Good Grief!

I can see I have my work cut out for me, that I will have to gird my loins, hold the sword of truth and probably sacrifice one of the dogs on the altar of DNA in the back yard.

(I’m going to pick Darwin because he sheds the most anyway.)

Or you could just send me your address and I’ll come burn down your house. Nanobyte, what are you doing this Saturday?

---

Are you driving with your eyes open or are you using The Force? - A. Foley