I’ve never been escorded in my life!
Geez, people, no one uses easily cut shuttle chains, you need a shuttle U-Lock, which can only be broken by modified shuttle jacks (used to prop up the shuttle in case of a flat nacelle)
Star Trek has never had flat nacelles, if you know what I mean. 
Just for you, Carn.
Er, thanks.
…Why didn’t they just beam it out?
And here I was thinking “the shuttle thief” was a sly reference to the classic neorealist film from Italy. I saw Travis standing wide-eyed on the sidewalk, staring in shock and horror as Trip, weeping uncontrollably, flew by in a stolen shuttlecraft.
But then I remembered where I was…
Ah… a feint within a feint…
Fascinating.
::singing:: “…life would be oh so sweet, if i were a bicycle seat…”
*I like to ride my bicycle
I like to ride my bike…*
Don’t you guys have a hobby or something?
ACTACACTTCAGGCTGGGCA
The red one has underbanding. Is this just because it coded a repeat region of the genome, is it simple junk, or is it a Single Nucleotide Polymorphism?
Now do you see why i sing of bicycle seats?
You’re looking at it.
…No, but I see why you might drink in the afternoon.
It’s because you forgot to reverse the polarity of the neutron flow through the quantum flux destabilizers, thereby flushing the Heisenberg compensators with soliton waves and re-energizing the ambivulent bivationary falvebarms.
I think it’s a Klingon gene, tracer.
I don’t think Cervaise likes us very much.
I bet he’s a Star Wars geek.
I don’t like you very much. :dubious:
ok, I’m just Malcolming you, I love you guys
You’re spozed to say, “I love you, man!!”
Malcolming? Malcolming? That sounds pretty disgusting.
Congrats on your creation of a new verb.
“Verbing weirds language.” --Calvin
Malcolming - a. the act of being a Malcolm;
b. being prissy, fawning, self deprecating, self defecating, pretentious, snobby, afraid of water, sleazy, overly fond of weaponry, having odd sexual fetishes;
c. hating water polo (see b.);
d. fooling around with Trek Dopers (in a non sexual way);
e. fooling around with Trek Dopers (in a sexual way);
f. hates cats and pineapple.
No no no, you’re supposed to say: “I don’t like you either. You just watch yourself. We’re wanted men. I have the death sentence on twelve systems!”